Саенко лариса: Лариса Саенко

Содержание

Почему американцы разрешают топтать свой флаг

Кто-то может полагать, что при виде сжигаемого Old Glory (так романтично американцы называют свой флаг) граждане США должны впадать в неистовство. Это не совсем так: в Америке глумление над стягом или иной символикой считается одним из проявлений свободы слова, гарантированной Первой поправкой Конституции США. 

Американцы и сами этого не знали до разъяснения Верховного суда в 1989 году, которое отменило действовавшее в 48 из 50 штатов уголовное наказание за надругательство над флагом.

Американец, который оплевал и сжег свой флаг

Новатором в деле осквернения национального символа стал Грегори Ли Джонсон, член молодежного крыла революционной компартии, стоящей на платформе маоизма. На марше в Далласе в 1984 году этот молодогвардеец устроил показательную расправу над полотнищем. Американские диссиденты скандировали “America, the red, white and blue, we spit on you” (“красно-бело-голубой” — разговорное наименование флага). И слово не расходилось с делом — оплевали и сожгли. Джонсон по части антиамериканизма заткнет за пояс не то что ярого русского патриота, но и идеолога “Аль-Каиды”. Флаг США для него — это “символ репрессий, узаконенного международного убийства и грабежа”. Какая участь ожидает “империю зла”, он доступно объяснял на революционных сходках, демонстрируя единомышленникам истекающую кровью отрубленную голову свиньи…

Случайный прохожий, ветеран Корейской войны Дэниел Уокер, не смог сдержать слез, глядя, как горит Old Glory. Когда толпа разошлась, он бережно собрал пепел и предал его земле на собственном подворье со всеми воинскими почестями, на которые был способен. Он был в числе свидетелей обвинения, описав невыносимые страдания и моральный вред, причиненные осквернителями национальной святыни. 

Джонсона приговорили к году тюрьмы и двум тысячам долларов штрафа, с чем он не согласился. Одну апелляцию он проиграл, вторую выиграл, и в итоге Верховный суд признал подобные поступки одной из разновидностей свободного выражения мнения. 

“Хотя надругательство над флагом глубоко оскорбительно для многих, правительство не может запретить выражение любых идей только потому, что общество находит эти идеи оскорбительными или неприемлемыми”, — заключил Верховный суд. Решение было принято с перевесом в один голос — 5 “за” при 4 “против”, в полной мере отразив раскол общества. 

Флаг им дорог, но Конституция дороже

То, что началось в Америке, было посерьезнее реакции российского общества на выходку Bloodhound Gang. Ведь это страна, где национальные флаги на флагштоках у дома — неизменные атрибуты провинциального быта, где в городах они свисают из окон и с балконов, развеваются по ветру на антеннах автомобилей, размещаются на бутсах, майках и трусах. День флага отмечается в этой стране с 1777-го года и перерос уже в Неделю флага, а в Пенсильвании, родном штате рокеров из Bloodhound Gang, в честь звездно-полосатого учрежден даже официальный выходной. 

Понятно, что ветераны и сторонники консервативных ценностей от Аляски до Техаса были в шоке от решения Верховного суда, а очевидец кощунства Уокер и вовсе слег. Сенат единодушно принял резолюцию, выражающую “глубокое разочарование”, президент Джордж Буш заявил, что он “очень, очень огорчен”. Законодатели попытались провести “Акт о защите национального флага”, предусматривающий кару за оскорбление “звездно-полосатого” даже за пределами США, но поняли, что эдак и до Третьей мировой войны недолго, и пункт сняли. 

Кипеж только раззадорил маоиста Джонсона. Он прибыл с друзьями прямо к Капитолию и повторил своей подвиг — облил керосином и подпалил “красно-бело-голубой”, приговаривая “гори, малыш, гори”. И снова был оправдан. Приятелям, правда, припаяли по три дня тюрьмы — не за кощунство над стягом, а за причинение ущерба госсобственности: купить флаг они не удосужились и стащили его со здания почтового офиса.

Провинциальная трагедия. Пропавший в Америке

Родившийся на Урале сирота теперь значится пропавшим без вести в Америке.

“Эта история будет меня мучить до конца жизни”

Нынешним летом Света и Настя, кажется, нашли настоящую семью. Известные в округе своей добросердечностью Майкл и Линда Тайс распахнули двери своего просторного дома для девочек и хотят стать им родными.

История русских сирот могла бы завершиться американским “хэппи эндом” – могла бы, если бы не пропавший мальчик. Если бы не то, что одну из девочек отправили на специальное лечение в психологическую клинику.

Если бы не то, что, в сущности, они уже не дети – Светлане 15, Насте в декабре будет 17, а Леша через пару месяцев станет совершеннолетним. Их детство прошло в доме на отшибе с заколоченными окнами, откуда последние годы их не выпускали даже в школу.

Из письма детского психолога Дайан Блэк:

“Я не могу принять эту историю и по сей день, и она будет меня мучить до конца моей жизни. Судьба этих сирот могла сложиться совсем по-иному, отними их у Декертов намного раньше. Ведь первый сигнал о том, что к детям применяется насилие, поступил десять лет назад, сразу после их усыновления! Я все время думаю, почему все случилось именно так – пытались ли эту историю замять, или на нашем пути оказались некомпетентные люди, или просто – безразличные?.. В моей душе – не триумф победителя, а горечь.”

“Мать очень злая, а отец – так себе, слегка”

Психолог Дайан Блэк случайно узнала Захария и семью Декерт – ее отправили на проверку анонимного звонка на “горячую линию”.

Первый раз ее не пустили на порог – встреча состоялась в местной церкви. А когда она попала в их дом и поговорила с Алексеем, то поняла – нельзя оставлять детей в этом странном доме с высоким забором и сторожевыми собаками.

Из личных записок Дайан Блэк для служебного рапорта после встречи с ребенком. Август 2008 года:

“Захарий. 12 лет. Описание: мелкий для своего возраста, выглядит на 8-9 лет. Говорит, что люди из службы защиты детей приходили раньше и пытались ему помочь. В школу не ходит, находится на домашнем школьном обучении, но не мог сказать с уверенностью, в каком классе. Он выглядел смышленым”.

Из рассказа Захария:

“Меня усыновили, когда мне было шесть или семь лет. Я был очень рад, когда меня забрали в Америку из российского детского дома… Но здесь меня бьют, не разрешают играть с друзьями, в наказание заставляют стоять на солнце (летом в Техасе жара достигает 40 градусов в тени)… Мама бьет меня, отец стегает ремнем, если мамы нет дома. Когда она дома, она сама меня сечет длинным прутом. Мать очень злая, а отец – так себе, слегка”.

Он сразу тронул сердце это женщины – тощий, немытый. Когда Майкл Декерт позвал его в комнату, мальчонка попытался придать себе наилучший вид, сдобрив чуб гелем и надушившись одеколоном.

– Чего же ты хочешь, такой ароматный? – спросила с улыбкой Дайан.

– Я хочу, чтобы меня усыновила любая другая семья, но только не эта, – сказал он при приемном отце, грустно глядя ей в глаза. И она не поняла, чего было больше в его голосе – надежды или отчаяния.

Соседи знали, что не все ладно в доме Декертов – Захарий постоянно убегал из дома, скрываясь в роще, окружавшей дом. Его держали взаперти в комнате с заколоченным окном, он спал на полу, ходил на ведро и получал еду, “если заслужил”. Жители близлежащих домов из жалости подкармливали мальчугана, иногда пускали на ночлег.

Полицейские знали, где прячется ребенок, и когда Декерты объявляли его в розыск, пара констеблей рутинно отлавливала беглеца и водворяла назад – под замок Декертов или под замок приюта для трудных малолеток.

Он не был пай-мальчиком: в школе тащил деньги у одноклассников, мог забраться в чужой дом, хотя там воровал только еду…

“Русское наследие”

“Тяжелое русское наследие”, – качали головами стражи порядка и работники попечительской службы, объясняя асоциальное, как значилось в протоколах, поведение Захария Декерта.

В их словах была доля правды. Ничего хорошего рассказать про свой пермский детский дом этот сирота не мог. И он ничего не помнил о своих биологических родителях. Говорил, что поначалу был рад даже интернату – по крайней мере, тепло и крыша над головой, а до этого они в России были бездомными. Все трое сирот Климовых мечтали о семье.

Из личных записок Дайан Блэк:

“Маленький, худой. Шрам на правой брови. Необстиранный, обувь с прорехами. Мать его друзей, узнав, как живется мальчику, сказала, что готова его усыновить. Отец после этого запретил ему общаться с ними… Говорит, что его бьют каждый день… Говорит, что помнит все про Россию, только не умеет разговаривать по-русски… На родном языке помнит только “спасибо”, “брат” и “любимая семья”. Усыновители запретили детям говорить по-русски, и те забыли родной язык”.

Она приступила к спешной подготовке документов для департамента защиты детей, полагая, что надо как можно скорей забрать сирот из семьи Декерт.

Приют Дайан Блэк

Дайан – старшая из трех детей инженера-электрика, который перебирался с одной военно-морской базы на другую в поисках работы. Ее бабушка с дедушкой жили в соседнем с Силсби городке, где она и вышла замуж. Супружество не было счастливым – муж бросил ее с тремя малышами. Оставшись без кормильца, молодая мать не опустила руки – она окончила колледж и стала учительницей.

Дети подросли, она пошла учиться дальше на степень мастера и стала завучем в школе. Но не успокоилась, продолжала учиться, чтобы стать психологом. На практике в местном департаменте защиты детей она впервые попала в детский приют, куда ее отправили оценить психическое состояние воспитанников.

Заштопанные одеяла, грустные или раздраженные дети и чрезмерно строгие воспитатели – все показалось ей слишком казенным и черствым.

“Выйдя из стен этого заведения, я подумала: все можно обустроить иначе. Я захотела создать собственный приют для обездоленных детей, в котором они почувствуют заботу и тепло. Свою мечту я вынашивала два года” – вспоминает Дайан.

Кафедра организации перевозок – Главная

В 2021 году кафедра организации перевозок ведет набор по следующим направлениям:

23.05.04 Эксплуатация железных дорог

Профили подготовки
Промышленный транспорт
Магистральный транспорт
Транспортный бизнес и логистика
Квалификация (степень) выпускника специалист
Нормативный срок обучения 5 лет
Форма обучения очная
План бюджетного набора 16 человек

23.05.04 Эксплуатация железных дорог

Профили подготовки
Промышленный транспорт
Магистральный транспорт
Транспортный бизнес и логистика
Квалификация (степень) выпускника
специалист
Нормативный срок обучения 6 лет
Форма обучения заочная
Прием на обучение ведется по договорам об оказании платных образовательных услуг

23.04.01 Технология транспортных процессов

Профиль подготовки
Организация перевозок и управление на транспорте (железнодорожный транспорт)
Квалификация (степень) выпускника магистр
Нормативный срок обучения 2 года
Форма обучения очная
План набора 5 человек
Прием на обучение ведется по договорам об оказании платных образовательных услуг

Саенко Лариса Семеновна

Саенко Лариса Семеновна

Отдел специального фортепиано

  • Должность: Преподаватель
  • Преподаваемые дисциплины: “Фортепиано”
  • Образование, специальность: Высшее, Ленинградская ордена Ленина Государственная консерватория имени Н.А.Римского-Корсакова. Специальность: Фортепиано. Квалификационная категория: Высшая.
  • Квалификация: Преподаватель, концертмейстер
  • Повышение квалификации / Профессиональная переподготовка: Курсы повышения квалификации по программе “Актуальные проблемы музыкальной педагогики”
  • Cтаж работы по специальности: 46 лет
  • Опыт работы: Работает в СПб ДМШ № 11 с 1979 года.

✅ ИП САЕНКО ЛАРИСА АЛЕКСАНДРОВНА, 🏙 Майкоп (OГРН 321010500008413, ИНН 010515997865) — 📄 реквизиты, 📞 контакты, ⭐ рейтинг

Последствия пандемии

В полной версии сервиса доступна вся информация по компаниям, которых коснулись последствия пандемии коронавируса: данные об ограничениях работы и о программе помощи от государства тем отраслям, которые испытывают падение спроса

Получить доступ

Краткая справка

ИП САЕНКО ЛАРИСА АЛЕКСАНДРОВНА было зарегистрировано 31 марта 2021 (существует 0 лет) под ИНН 010515997865 и ОГРНИП 321010500008413. Местонахождение Республика Адыгея, г. Майкоп. Основной вид деятельности ИП САЕНКО ЛАРИСА АЛЕКСАНДРОВНА: 46.74 Торговля оптовая скобяными изделиями, водопроводным и отопительным оборудованием и принадлежностями Эта группировка включает – оптовую торговлю металлическими изделиями и замками; – оптовую торговлю. Телефон, адрес электронной почты, адрес официального сайта и другие контактные данные ИП САЕНКО ЛАРИСА АЛЕКСАНДРОВНА отсутствуют в ЕГРИП.

Информация на сайте предоставлена из официальных открытых государственных источников.

Контакты ИП САЕНКО ЛАРИСА АЛЕКСАНДРОВНА

Местонахождение

Россия, Республика Адыгея, г. Майкоп

Зарегистрирован 31 марта 2021

Перейти ко всем адресам


Телефоны


Электронная почта


Лариса Саенко. Мировая премьера фильма об Анне Политковской состоялась в Нью-Йорке

— 20 августа 2011 г. —

Лариса Саенко. Мировая премьера фильма об Анне Политковской состоялась в Нью-Йорке

НЬЮ-ЙОРК, 20 авг – РИА Новости. Ожидаемая премьера документальной ленты Марины Голдовской “Горький вкус свободы” (A Bitter Taste of Freedom) при полном аншлаге состоялась в пятницу вечером на Манхэттене в рамках 15-й Нью-Йоркской недели документального кино.

Международная ассоциация документалистов уже оформляет процедуру выдвижения этой полуторачасовой ленты на “Оскара”, сказала автор, когда в зале стихли аплодисменты и включили свет.

“Есть люди с толстой кожей, есть люди с тонкой кожей. Анна Политковская вообще была без кожи. Она однажды уехала на войну в Чечню и никогда оттуда не вернулась”, – сказала Голдовская РИА Новости после премьеры.

Режиссер сидела, как и многие, на полу, поскольку свободных кресел в зале не было, и было видно, что некоторые сцены она переживала так эмоционально, словно это было в перый раз, – то улыбаясь, то заламывая пальцы.

Марина знала семью Политковских почти тридцать лет, и почти столько же длились съемки фильма, запечатлевшие и историю распавшейся семьи, и романтизм перестройки, и трагизм крушения СССР, и многотысячные политические митинги, и драки в очередях.

Уроженка СССР, живущая в Лос-Анджелесе, она жадно вбирала все происходящие в России события, она снимала практически все, что попадало в объектив ее почти любительской камеры.

Об убийстве Анны Политковской 7 октября 2006 года у подъезда ее собственного дома Голдовская узнала не из выпусков новостей – ей позвонили в Лос-Анджелес дети подруги и спросили: “Вы сделаете фильм о маме?”.

Марина не спешила, она внимательно смотрела фильмы, отснятые о Политковской другими режиссерами по горячим следам трагической гибели 48-летней журналистки и правозащитницы.

“Все это время я думала, что я могу сказать иное об Анне, которую не только любили, но и ненавидели, к которой шли за помощью и которую бичевали за ее апассионарность, которую представляли “железной леди”, хотя она жила тем, что помогала людям в беде… И я показала ее такой, какой знала сама – нежной, ранимой женщиной”, – сказала Голдовская.

Ее Политковская, которую откачивают в госпитале после отравления в самолете, когда она летела в Беслан, признается, как невыносимо трудна ей ее социальная роль, и что если власти предпримут штурм школы с захваченными террористами детьми, она расстанется с журналистикой. Ее Анна ковыряет вилкой свой ужин в скромном интерьере, ласкает обожающего ее пса и признается на кухне, кокетливо закатывая глаза, что влюбилась…

“Для кого я создавала этот фильм? В первую очередь для россиян. Они как никто другой могут понять душу этой женщины. Я хотела тронуть сердца людей в наш век циничного прагматизма”, – сказала Голдовская публике после премьеры.

Фильм “Горький вкус свободы” – не о политике, и режиссер не пытается спекулировать на расхожих версиях о причастности каких-то чиновников к убийству. Она рада, что ленту пригласили на московский кинофестиваль в ноябре и ее смогут увидеть в России.

Профессор киношколы университета Южной Калифорнии Голдовская входит в число увенчанных наградами и титулами мировых классиков документалистики. Она создала десятки фильмов, ее героями были Аркадий Райкин, Олег Ефремов, Валентина Терешкова… Но Анна Политковская была ее любимым персонажем и человеком – возможно, потому, что ярче и трагичней других отразила своей жизнью отрезок жизни страны, признается мастер.

Саєнко Лариса Іванівна від НАЗК

1.   Тип декларації та звітний період

Щорічна
особи, уповноваженої на виконання функцій держави або місцевого самоврядування (охоплює попередній рік) 2016

2.1.   Інформація про суб’єкта декларування

Прізвище: Саєнко

Ім’я: Лариса

По батькові (за наявності): Іванівна

Податковий номер: [Конфіденційна інформація]

Дата народження: [Конфіденційна інформація]


Зареєстроване місце проживання:

Країна: Україна

Поштовий індекс: [Конфіденційна інформація] 

Місто, селище чи село: Південне / Харківський район / Харківська область / Україна

Вулиця: [Конфіденційна інформація]

Номер будинку: [Конфіденційна інформація]

Номер корпусу: [Конфіденційна інформація]

Номер квартири: [Конфіденційна інформація]


Місце фактичного проживання або поштова адреса, на яку Національне агентство з питань запобігання корупції може надсилати кореспонденцію суб’єкту декларування: Збігається з місцем реєстрації
Місце роботи:

Місце роботи або проходження служби (або місце майбутньої роботи чи проходження служби для кандидатів): Харківська об’єднана державна податкова інспекція Головного управління ДФС у Харківській області

Займана посада (або посада, на яку претендуєте як кандидат): заступник начальника відділу


Категорія посади (заповніть, якщо це вас стосується):

Тип посади: Посада державної служби

Категорія посади: Б

Чи відноситесь ви до службових осіб, які займають відповідальне та особливо відповідальне становище, відповідно до статті 50 Закону України “Про запобігання корупції”? Державний службовець, посада якого належить до посад державної служби категорії ‘А’ або ‘Б’

Чи належить ваша посада до посад, пов’язаних з високим рівнем корупційних ризиків, згідно з переліком, затвердженим Національним агентством з питань запобігання корупції? Ні

2.2.  Інформація про членів сім’ї суб’єкта декларування

Членами сім’ї суб’єкта декларування є: особи, які перебувають у шлюбі із суб’єктом декларування (чоловік/дружина), незалежного від того, чи вони проживають спільно; діти, у тому числі повнолітні діти, батьки, особи, які перебувають під опікою і піклуванням, інші особи, які спільно проживають, пов’язані спільним побутом, мають взаємні права та обов’язки із суб’єктом декларування (крім осіб, взаємні права та обов’язки яких не мають характеру сімейних – наприклад, особи, що спільно орендують житло), у тому числі особи, які спільно проживають із суб’єктом декларування, але не перебувають з ним у шлюбі.

Зв’язок із суб’єктом декларування Прізвище, ім’я, по батькові Громадянство Податковий номер
синПрізвище: СаєнкоІм’я: Сергій По батькові: ОлександровичДата народження: [Конфіденційна інформація]Україна[Конфіденційна інформація]

3.   Об’єкти нерухомості

Суб’єкт декларування повинен задекларувати всі об’єкти нерухомості, що належать йому або членам його сім’ї на праві власності, знаходяться у них в оренді чи на іншому праві користування, незалежно від форми укладення правочину, внаслідок якого набуте таке право. Це включає такі об’єкти нерухомості: земельна ділянка, житловий будинок, квартира, офіс, садовий (дачний) будинок, гараж, інше.

Загальна інформація Місцезнаходження Вартість на дату набуття Вартість за останньою оцінкою Інформація щодо прав на об’єкт
Вид об’єкта:Житловий будинок Дата набуття права:08.12.2012 Загальна площа (м2): 111,8 Реєстраційний номер:[Конфіденційна інформація]Прізвище: СаєнкоІм’я: ЛарисаПо батькові: ІванівнаКраїна:Україна Поштовий індекс:[Конфіденційна інформація] Населений пункт:Південне / Харківський район / Харківська область / Україна Адреса:[Конфіденційна інформація][Не відомо] [Не відомо] Тип права: Інше право користуванняВідсоток, %: [Не застосовується] Інший тип: проживанняВласник: Громадянин УкраїниПрізвище: СаєнкоІм’я: ГалинаПо батькові: ІванівнаДата народження: [Конфіденційна інформація]Податковий номер: [Конфіденційна інформація]Зареєстроване місце проживання: [Конфіденційна інформація]Місце фактичного проживання: [Конфіденційна інформація]
Вид об’єкта:Земельна ділянка Дата набуття права:07.12.2005 Загальна площа (м2): 600 Кадастровий номер:[Конфіденційна інформація]Прізвище: СаєнкоІм’я: ЛарисаПо батькові: ІванівнаКраїна:Україна Поштовий індекс:[Конфіденційна інформація] Населений пункт:Південне / Харківський район / Харківська область / Україна Адреса:[Конфіденційна інформація][Не відомо] [Не відомо] Тип права: Інше право користуванняВідсоток, %: [Не застосовується] Інший тип: проживання, користуванняВласник: Громадянин УкраїниПрізвище: СаєнкоІм’я: ГалинаПо батькові: ІванівнаДата народження: [Конфіденційна інформація]Податковий номер: [Конфіденційна інформація]Зареєстроване місце проживання: [Конфіденційна інформація]Місце фактичного проживання: [Конфіденційна інформація]
Вид об’єкта:Земельна ділянка Дата набуття права:21.06.2004 Загальна площа (м2): 1000 Кадастровий номер:[Конфіденційна інформація]Прізвище: СаєнкоІм’я: ЛарисаПо батькові: ІванівнаКраїна:Україна Поштовий індекс:[Конфіденційна інформація] Населений пункт:Південне / Харківський район / Харківська область / Україна Адреса:[Конфіденційна інформація][Не відомо] [Не відомо] Тип права: ВласністьВідсоток, %: 100Прізвище: СаєнкоІм’я: ЛарисаПо батькові: Іванівна
Вид об’єкта:Земельна ділянка Дата набуття права:17.12.1993 Загальна площа (м2): 5000 Кадастровий номер:[Конфіденційна інформація]Прізвище: СаєнкоІм’я: ЛарисаПо батькові: ІванівнаКраїна:Україна Поштовий індекс:[Конфіденційна інформація] Населений пункт:Березівка / Харківський район / Харківська область / Україна Адреса:[Конфіденційна інформація][Не відомо] [Не відомо] Тип права: ВласністьВідсоток, %: 100Прізвище: СаєнкоІм’я: ЛарисаПо батькові: Іванівна
Вид об’єкта:Земельна ділянка Дата набуття права:11.12.2012 Загальна площа (м2): 1000 Кадастровий номер:[Конфіденційна інформація]Прізвище: СаєнкоІм’я: ЛарисаПо батькові: ІванівнаКраїна:Україна Поштовий індекс:[Конфіденційна інформація] Населений пункт:Березівка / Харківський район / Харківська область / Україна Адреса:[Конфіденційна інформація][Не відомо] [Не відомо] Тип права: ВласністьВідсоток, %: 100Прізвище: СаєнкоІм’я: ЛарисаПо батькові: Іванівна
Вид об’єкта:Житловий будинок Дата набуття права:31.12.2016 Загальна площа (м2): 111,8 Реєстраційний номер:[Конфіденційна інформація]Декларує:синПрізвище: СаєнкоІм’я: Сергій По батькові: ОлександровичКраїна:Україна Поштовий індекс:[Конфіденційна інформація] Населений пункт:Південне / Харківський район / Харківська область / Україна Адреса:[Конфіденційна інформація][Не відомо] [Не відомо] Тип права: Інше право користуванняВідсоток, %: [Не застосовується] Інший тип: користуванняВласник: Громадянин УкраїниПрізвище: Саєнко Ім’я: ГалинаПо батькові: ІванівнаДата народження: [Конфіденційна інформація]Податковий номер: [Конфіденційна інформація]Зареєстроване місце проживання: [Конфіденційна інформація]Місце фактичного проживання: [Конфіденційна інформація]
Вид об’єкта:Земельна ділянка Дата набуття права:31.12.2016 Загальна площа (м2): 600 Кадастровий номер:[Конфіденційна інформація]Декларує:синПрізвище: СаєнкоІм’я: Сергій По батькові: ОлександровичКраїна:Україна Поштовий індекс:[Конфіденційна інформація] Населений пункт:Південне / Харківський район / Харківська область / Україна Адреса:[Конфіденційна інформація][Не відомо] [Не відомо] Тип права: Інше право користуванняВідсоток, %: [Не застосовується] Інший тип: постійне користуванняВласник: Громадянин УкраїниПрізвище: СаєнкоІм’я: ГалинаПо батькові: ІванівнаДата народження: [Конфіденційна інформація]Податковий номер: [Конфіденційна інформація]Зареєстроване місце проживання: [Конфіденційна інформація]Місце фактичного проживання: [Конфіденційна інформація]

4.   Об’єкти незавершеного будівництва

Суб’єкт декларування повинен задекларувати: 1) об’єкти незавершеного будівництва; 2) об’єкти, не прийняті в експлуатацію; або 3) об’єкти, право власності на які не зареєстроване в установленому законом порядку.

Такі об’єкти декларуються, якщо вони: а) належать суб’єкту декларування або членам його сім’ї на праві власності відповідно до Цивільного кодексу України; б) розташовані на земельних ділянках, що належать суб’єкту декларування або членам його сім’ї на праві приватної власності, включаючи спільну власність, або передані їм в оренду чи на іншому праві користування, незалежно від правових підстав набуття такого права; або в) повністю або частково побудовані з матеріалів чи за кошти суб’єкта декларування або членів його сім’ї.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

5.   Цінне рухоме майно (крім транспортних засобів)

Суб’єкт декларування повинен задекларувати: цінне рухоме майно, вартість якого перевищує 100 прожиткових мінімумів, встановленних для працездатних осіб на 1 січня звітного року. Під рухомим майном розуміються будь-які матеріальні об’єкти, які можуть бути переміщеними без заподіяння їм шкоди (наприклад, ювелірні вироби, персональні або домашні електронні пристрої, одяг, твори мистецтва, антикваріат тощо).

У цьому розділі декларації НЕ декларується таке майно: цінні папери, корпоративні права, готівкові кошти, кошти на рахунках в банку чи інших фінансових установах, дорогоцінні (банківські) метали.

Якщо рухоме майно є одночасно подарунком, то воно декларується як в цьому розділі (у разі перевищення зазначеного порогу декларування), так і в розділі “Доходи, у тому числі подарунки”.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

6.   Цінне рухоме майно – транспортні засоби

Суб’єкт декларування повинен задекларувати: транспортні засоби та інші самохідні машини і механізми незалежно від їх вартості.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

7.   Цінні папери

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

8.   Корпоративні права

Суб’єкт декларування повинен задекларувати: будь-які корпоративні права, крім акцій, зазначених в попередньому розділі декларації, у тому числі частки (паї) у статутному (складеному) капіталі чи в будь-якому іншому еквіваленті статутного капіталу товариства, підприємства, організації, що зареєстровані в Україні або за кордоном, у тому числі пайові внески в кредитній спілці.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

9.   Юридичні особи, кінцевим бенефіціарним власником (контролером) яких є суб’єкт декларування або члени його сім’ї

Суб’єкт декларування повинен задекларувати: будь-які корпоративні права, крім акцій, зазначених в попередньому розділі декларації, у тому числі частки (паї) у статутному (складеному) капіталі чи в будь-якому іншому еквіваленті статутного капіталу товариства, підприємства, організації, що зареєстровані в Україні або за кордоном, у тому числі пайові внески в кредитній спілці.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

10.   Нематеріальні активи

Нематеріальні активи включають: об’єкти права інтелектуальної власності, що можуть бути оцінені в грошовому еквіваленті (право на винахід, корисну модель, ноу-хау, промисловий зразок, топографії інтегральної мікросхеми, сорт рослин, торгову марку чи комерційне найменування, авторське право тощо), право на використання надр чи інших природних ресурсів, інше.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

11.   Доходи, у тому числі подарунки

Суб’єкт декларування повинен зазначити отриманий (нарахований) дохід упродовж звітного періоду.

Доходи включають: заробітну плату (грошове забезпечення), отриману як за основним місцем роботи, так і за сумісництвом, гонорари та інші виплати згідно з цивільно-правовими правочинами, дохід від зайняття підприємницькою або незалежною професійною діяльністю, дохід від надання майна в оренду, дивіденди, проценти, роялті, страхові виплати, благодійну допомогу, пенсію, спадщину, доходи від відчуження цінних паперів та корпоративних прав, подарунки та інші доходи. Під заробітною платою розуміється основна заробітна плата, а також будь-які заохочувальні та компенсаційні виплати, які виплачуються (надаються) особі у зв’язку з відносинами трудового найму.

Подарунки у формі грошових коштів ​повинні зазначатися, якщо розмір таких подарунків, отриманих від однієї особи (групи осіб) протягом року,​ перевищує 5 прожиткових мінімумів, встановленних для працездатних осіб на 1 січня звітного року.Подарун​ок​ у формі, іншій ніж грошові кошти​ (рухоме майно, нерухомість тощо)​, зазначається​, якщо ​вартість так​ого​ подарунк​у перевищує 5 прожиткових мінімумів, встановленних для працездатних осіб на 1 січня звітного року. Зазначення інформації про подарунок не виключає обов’язок вказати відповідне майно в інших розділах декларації, наприклад, у розділах про цінне рухоме майно, нерухоме майно, цінні папери тощо.

Джерело доходуВид доходуРозмір (вартість)Інформація щодо права власності
Джерело доходу:Юридична особа, зареєстрована в УкраїніНайменування: Харківська ОДПІ ГУ ДФС у Харківській областіКод в Єдиному державному реєстрі юридичних осіб, фізичних осіб – підприємців та громадських формувань:  39859695 Декларує:Прізвище: СаєнкоІм’я: ЛарисаПо батькові: ІванівнаЗаробітна плата отримана за основним місцем роботи70715Тип права: ВласністьПрізвище: СаєнкоІм’я: ЛарисаПо батькові: Іванівна
Джерело доходу:Юридична особа, зареєстрована в УкраїніНайменування: Відділ освіти Харківської РДАКод в Єдиному державному реєстрі юридичних осіб, фізичних осіб – підприємців та громадських формувань:  02146191 Декларує:синПрізвище: СаєнкоІм’я: Сергій По батькові: ОлександровичІнше: Стипендія ХРДА750Тип права: ВласністьВласник: синПрізвище: СаєнкоІм’я: СергійПо батькові: Олександрович
Джерело доходу:Юридична особа, зареєстрована в УкраїніНайменування: НТУ “ХПІ”Код в Єдиному державному реєстрі юридичних осіб, фізичних осіб – підприємців та громадських формувань:  02071180 Декларує:синПрізвище: СаєнкоІм’я: Сергій По батькові: ОлександровичІнше: Стипендія3300Тип права: ВласністьВласник: синПрізвище: СаєнкоІм’я: СергійПо батькові: Олександрович

12.   Грошові активи

Суб’єкт декларування повинен задекларувати: готівкові кошти, кошти, розміщені на банківських рахунках, внески до кредитних спілок та інших небанківських фінансових установ, у тому числі до інститутів спільного інвестування, кошти, позичені суб’єктом декларування або членом його сім’ї третім особам, активи у дорогоцінних (банківських) металах, інше.

Не підлягають декларуванню наявні грошові активи (у тому числі готівкові кошти, кошти, розміщені на банківських рахунках, внески до кредитних спілок та інших небанківських фінансових установ, кошти, позичені третім особам) та активи у дорогоцінних (банківських) металах, сукупна вартість яких не перевищує 50 прожиткових мінімумів, встановленних для працездатних осіб на 1 січня звітного року.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

13.   Фінансові зобов’язання

Суб’єкт декларування повинен задекларувати: отримані кредити, отримані позики, зобов’язання за договорами лізингу, розмір сплачених коштів в рахунок основної суми позики (кредиту) та процентів за позикою (кредитом), зобов’язання за договорами страхування та недержавного пенсійного забезпечення, кошти, позичені суб’єкту декларування або члену його сім’ї іншими особами, несплачені податкові зобов’язання, інше.

Інформація зазначається, лише якщо розмір зобов’язання перевищує 50 прожиткових мінімумів, встановленних для працездатних осіб на 1 січня звітного року. Якщо розмір зобов’язання не перевищує 50 прожиткових мінімумів, встановленних для працездатних осіб на 1 січня звітного року, зазначається лише загальний розмір такого фінансового зобов’язання (наприклад, якщо розмір сплачених коштів в рахунок основної суми позики (кредиту) у звітному році не перевищує 50 прожиткових мінімумів, встановленних для працездатних осіб на 1 січня звітного року, то зазначається лише загальний розмір позики (кредиту)).

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

14.   Видатки та правочини суб’єкта декларування

Суб’єкт декларування повинен задекларувати: видатки та всі правочини, вчинені у звітному періоді, на підставі яких у суб’єкта декларування виникає або припиняється право власності, володіння чи користування, у тому числі спільної власності, на нерухоме або рухоме майно, нематеріальні та інші активи, а також виникають фінансові зобов’язання, які зазначені у розділах 3–12 цієї декларації.

Відомості про видатки та правочини зазначаються лише у разі, якщо розмір відповідного видатку (вартість предмету правочину) перевищує 50 прожиткових мінімумів, встановленних для працездатних осіб на 1 січня звітного року.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

15.    Робота за сумісництвом суб’єкта декларування

Суб’єкт декларування повинен задекларувати: посаду чи роботу, що виконується або виконувалася за сумісництвом.

Зайняття посади чи робота за сумісництвом декларується, якщо її зайняття (виконання) розпочалося або продовжувалося під час звітного періоду незалежно від тривалості.

Посада чи робота за сумісництвом декларується незалежно від того, чи була вона оплачуваною.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

16.  Членство суб’єкта декларування в організаціях та їх органах

Суб’єкт декларування повинен задекларувати: посаду чи роботу, що виконується або виконувалася за сумісництвом.

Зайняття посади чи робота за сумісництвом декларується, якщо її зайняття (виконання) розпочалося або продовжувалося під час звітного періоду незалежно від тривалості.

Посада чи робота за сумісництвом декларується незалежно від того, чи була вона оплачуваною.

Організації, у яких суб’єкт декларування є членом.

У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі Членство в органах організацій.У суб’єкта декларування чи членів його сім’ї відсутні об’єкти для декларування в цьому розділі

Документ підписано:

САЄНКО ЛАРИСА ІВАНІВНА

легких цепей в субпопуляциях анти-двухцепочечной ДНК В-клеток: роль в определении клеточной судьбы | Журнал экспериментальной медицины

Два основных механизма регуляции аутореактивных В-клеток, которые возникают в костном мозге, – это функциональное молчание (анергия) и делеция. На сегодняшний день исследования показывают, что взаимодействия с низкой авидностью между В-клетками и аутоантигеном приводят к молчанию В-клеток, тогда как взаимодействия с высокой авидностью приводят к делеции. Антитела к двухцепочечной (ds) ДНК представляют собой патогенную аутоспецифичность при системной красной волчанке (СКВ).Понимание их регуляции имеет решающее значение для понимания СКВ. Теперь мы демонстрируем на трансгенной модели, в которой мыши экспрессируют тяжелую цепь потенциально патогенного анти-ДНК-антитела, что сродство антитела к дцДНК само по себе не определяет судьбу В-клеток анти-дцДНК. В-клетки, вырабатывающие антитела с аналогичным сродством к дцДНК, регулируются по-разному, в зависимости от использования легкой цепи. Основным следствием этого наблюдения является то, что дцДНК может не быть аутоантигеном, ответственным за определение клеточной судьбы В-клеток против дцДНК.Использование легкой цепи может определять антигенную перекрестную реактивность, а перекрестно-реактивные антигены могут регулировать В-клетки, которые также связывают дцДНК.

Анти-двухцепочечные (ds) 1 ДНК-антитела характерны для аутоиммунного заболевания СКВ, а титры антител IgG к анти-дцДНК в сыворотке крови пациентов коррелируют с активностью заболевания и нефритом. Анализ локусов гена вариабельной области иммуноглобулина не выявил различий между аутоиммунными и неаутоиммунными линиями мышей, а также различий в родственных связях людей, которые связаны с аутоиммунным заболеванием.Кроме того, гены вариабельной области иммуноглобулина (V), используемые как в мышиных, так и в человеческих антителах к ДНК, также используются для создания репертуара защитных антител (1–5).

Изучение регуляции аутореактивных В-клеток стало возможным с появлением трансгенных технологий. Анализы В-клеток, экспрессирующих аутоантитела, кодируемые трансгенами, продемонстрировали существование нескольких механизмов поддержания самотолерантности: функциональное молчание или анергия, делеция и редактирование рецептора (6-13).Основываясь на исследованиях, проведенных в нескольких лабораториях, Гуднау предположил, что существуют пороги занятости рецепторов, которые коррелируют с различными механизмами регуляции (14). Согласно этой модели делеция происходит в условиях обширного перекрестного связывания рецепторов, тогда как молчание происходит в условиях более умеренного перекрестного связывания.

Для изучения регуляции антител против дцДНК мы ранее создали неаутоиммунных мышей BALB / c и NZW, трансгенных по тяжелой цепи γ2b антитела против дцДНК R4A.Антитело R4A кодируется геном тяжелой цепи V11 S107 и геном легкой цепи Vk1, связывает дцДНК и откладывается в клубочках мышей SCID (15, 16). У трансгенных мышей BALB / c и NZW, трансгенных по R4A-γ2b, в сыворотке присутствует незначительная анти-ДНК-активность, и слияние нестимулированных спленоцитов этих мышей не дает гибридомы, экспрессирующей трансген против dsDNA. Однако В-клетки против дцДНК присутствуют в селезенках этих мышей и могут быть активированы in vitro с помощью ЛПС для секреции кодируемых трансгеном антител против дцДНК.Кроме того, гибридомы R4A против дцДНК можно получить от этих мышей, если перед слиянием спленоциты стимулировать in vitro LPS (9, 17).

В настоящем исследовании мы сравнили экспрессию трансгена у неаутоиммунных мышей BALB / c и NZW и аутоиммунных мышей NZB / W F1. Хотя в сыворотке мышей BALB / c и NZW присутствует незначительная анти-ДНК-активность, кодируемая трансгеном, такая активность присутствует в сыворотке всех мышей NZB / W F1. Анализ гибридом показывает, что трансген-экспрессирующие В-клетки против дцДНК от мышей NZB / W F1 используют широкий спектр генов легких цепей.Напротив, В-клетки против дцДНК от неаутоиммунных мышей используют почти исключительно гены Vk1. Таким образом, существуют две популяции B-клеток против дцДНК, которые дифференцированно регулируются у неаутоиммунных мышей. Существует подмножество анти-дцДНК Vk1, которое присутствует, но функционально молчащее, и подмножество не-Vk1, которое нацелено на удаление. На аутоиммунном фоне NZB / W F1 обе популяции активируются in vivo. Поскольку Vk1 и не-Vk1 анти-дцДНК-антитела имеют схожую аффинность к дцДНК, эту критическую, потенциально патогенную специфичность нельзя регулировать только связыванием с дцДНК.Необходимо рассмотреть альтернативные модели регуляции, в которых судьба клеток определяется использованием легкой цепи.

Клоны гибридом

были проверены на экспрессию генов R4A-γ2b и Vk1 с помощью дот-блоттинга РНК с использованием зондов, специфичных для семейств генов S107 и Vk1 мыши, как описано ранее (17). Зонд Vk1 был предоставлен доктором К. Шилдкраутом (Медицинский колледж Альберта Эйнштейна, Бронкс, Нью-Йорк; ссылка 18).

Тотальную РНК выделяли из гибридом (набор Ultraspec RNA; Biotecx Labs., Хьюстон, Техас). Первая цепь кДНК для генов тяжелой цепи R4A и легкой цепи κ была синтезирована с использованием 10 мкг РНК и 100 нг антисмысловых олигонуклеотидных праймеров, специфичных для константной области гамма мыши (TGGACAGGGA / CTCCAG / TAGTTC) и для константной области легкой цепи κ мыши. (ACACTCATTCCTGTTGAA). ПЦР-амплификацию проводили с использованием вент-полимеразы. Для гена тяжелой цепи R4A использовали олигомер, специфичный для каркаса 1 (FR1; GGTGAAGCTGGTGGAATCTGG), и праймер константной области гамма; для генов легкой цепи каппа использовали Vk1, FR1-специфический олигомер (CCAGCAGTGATGTTGTGATGACCC) или смесь вырожденных олигомеров FR1, Vk (19) и праймер константной области κ.Продукты ПЦР секвенировали с помощью системы секвенирования цикла дцДНК (GIBCO BRL, Gaithersburg, MD) с использованием константной области, FR1 и внутренних праймеров. Реакции секвенирования подвергали электрофорезу в 6 или 7% акриламидных гелях.

Аллельное исключение гибридом анти-дцДНК определяли с помощью ELISA, как описано ранее (17). Вкратце, 96-луночные планшеты Falcon (Becton Dickinson, Lincoln Park, NJ) были покрыты разведением 1/1000 козьих антимышиных антител к IgM, IgG1, IgG3, IgG2a или IgG2b (Southern Biotechnology Assoc., Бирмингем, Алабама). После блокирования планшетов в PBS, 1,0% BSA, клеточные супернатанты, нормализованные до 10 мкг / мл, добавляли в лунки на 1 час при 37 ° C с последующим добавлением козьих антимышиных IgM, IgG1, IgG3, IgG2a или антител IgG2b. соответственно, конъюгированные с щелочной фосфатазой (Southern Biotechnology Assoc.). Все отмывки ELISA выполнялись с использованием PBS – 0,05% твин. ELISA проявляли с использованием динатрий-нитрофенилфосфата p в качестве субстрата (Sigma Chemical Co., Сент-Луис, Миссури), и ELISA считывали при 405 нм в считывающем устройстве для ELISA Titertek-Multiscan.

Константы аффинности для выбранных антител против дцДНК определяли согласно ELISA по ингибированию антигена, как описано Nieto et al. (20). Планшеты Immulon 2 были покрыты 100 мкг / мл ДНК спермы лосося и заблокированы в PBS, 1,0% BSA. Супернатанты гибридом, разбавленные до концентрации антител, которая находилась в линейном диапазоне на кривой титрования антител против дцДНК, затем инкубировали в лунках планшетов для ELISA вместе с возрастающими концентрациями растворимой ДНК спермы лосося, используемой в качестве ингибитора (0.0–2 мг / мл) в течение 2 ч при 37 ° C. Лунки промывали и инкубировали в течение 1 ч при 37 ° C с козьим антимышиным IgG2b, конъюгированным с щелочной фосфатазой, и проявляли раствором субстрата, как описано выше. Измерения ELISA считывали при 405 нм на ридере Titertek Multiscan ELISA. Видимое сродство рассчитывали на основе концентрации растворимой ДНК, приводящей к 50% ингибированию связывания антител (20).

Константы диссоциации определяли по методу Friguet et al.(21). Вкратце, линеаризованная плазмидная ДНК была никотранслирована с 32 Р-меченных дезоксинуклеотидтрифосфатов. Постоянное количество антител объединяли с различными количествами радиоактивно меченной ДНК (5–100 нг), доводили до конечного объема 1,0 мл с помощью SSC, а затем инкубировали в течение 3 ч при комнатной температуре. Комплексы антитело-дцДНК улавливали на миллипоровых фильтрах НА 0,45 мкм (Millipore Corp., Бедфорд, Массачусетс). Связанную радиоактивность регистрировали на жидкостном сцинтилляционном счетчике. Результаты были нанесены на график, и константы диссоциации были получены из наклона линейной регрессии.

В то время как спленоциты от неаутоиммунных трансгенных мышей NZW и BALB / c R4A-γ2b могут быть индуцированы к секретированию кодируемых трансгеном антител против дцДНК с помощью стимуляции in vitro с помощью ЛПС, спонтанная секреция антител против γ2b к ДНК у этих мышей незначительна (9). Напротив, трансгенные мыши NZB / W F1 R4A-γ2b имеют повышенные титры анти-дцДНК γ2b. Эти антитела кодируются трансгеном; в возрасте 2,5–3 мес. повышенные титры ДНК-связывающей активности γ2b присутствуют только в сыворотке трансгенных мышей NZB / W F1, но не у нетрансгенных однопометников (рис.1).

Чтобы понять дифференциальную регуляцию В-клеток против дцДНК у аутоиммунных и неаутоиммунных мышей, мы создали гибридомы против дцДНК, кодируемые трансгеном. Нам удалось получить гибридомы, продуцирующие анти-дцДНК, от мышей NZW или BALB / c, только если спленоциты культивировали с LPS перед слиянием (17). 5–10% гибридом из стимулированных ЛПС спленоцитов, экспрессирующих дцДНК с трансгеном R4A-γ2b. Подробно проанализированы 20 гибридом анти-дцДНК, 9 от мышей NZW и 11 от мышей BALB / c.Экспрессию трансгена в этих клонах проверяли секвенированием через соединение VDJ тяжелой цепи γ2b во всех гибридомах и по всей V-области пополам. Анализ последовательности показал, что тяжелая цепь кодируется трансгеном во всех случаях, и, кроме того, выявил отсутствие соматической мутации тяжелой цепи R4A.

Для исследования эндогенных легких цепей, экспрессируемых в этих гибридомах, мы сначала искали экспрессию транскрипта Vk1 с помощью дот-блоттинга РНК, поскольку антитело R4A «дикого типа» обладает легкой цепью Vk1 (15).17 из 20 линий экспрессировали легкую цепь Vk1. Все легкие цепи секвенировали (фиг. 2), подтверждая идентификацию легкой цепи, полученную с помощью дот-блоттинга РНК. Ген Vk1-A использовался в большинстве (12) гибридом. 16 генов легкой цепи Vk1 были соматически мутированы. Три не связанные с Vk1 анти-дцДНК легкие цепи, BA12BB2, BA12BD-1 и BA1227, были получены из гибридом BALB / c и кодируются генами Vk21, Vk2 и Vk4 / 5 соответственно (данные не показаны).

Трансген-экспрессирующие гибридомы против дцДНК от R4A-γ2b трансгенных мышей NZB / W F1 можно было получить из не-LPS-активированных B-клеток, а также из LPS-активированных спленоцитов, подтверждая активацию in vivo B-клеток antidsDNA у аутоиммунных мышей.В отличие от доминантного использования Vk1, наблюдаемого у неаутоиммунных мышей, только 5 из 16 аутоиммунных гибридом анти-дцДНК используют ген Vk1 (Таблица 1). Из спленоцитов, стимулированных ЛПС, было получено 12 клеточных линий, из которых только 4 (33%) используют гены Vk1. Только 1 из 4 клеточных линий, полученных из нестимулированных спленоцитов F1 NZB / W (25%), использует легкую цепь Vk1. Следовательно, существует небольшая разница в частоте экспрессии Vk1 в гибридомах из LPS-стимулированных и нестимулированных спленоцитов. Гены Vk1 из гибридом NZB / W F1 не обнаруживают соматических мутаций в трех (BW19G10, BW21D11 и BW10D9) из пяти секвенированных генов Vk1 (рис.3). Изменение основания, наблюдаемое на стыке Vk и Jk в Bw19G10 и BW21D11, вероятно, является результатом неточного соединения во время перегруппировки Vk-Jk.

Остальные 11 гибридом используют легкие цепи из восьми различных семейств генов легких цепей, не относящихся к Vk1 (рис. 4), включая два из семейства Vk10 и три из семейства Vk4 / 5. Поскольку ни один из генов, не относящихся к Vk1, имеет 100% гомологию с любыми генами зародышевой линии, указанными в базе данных EMBL / GenBank / DDBJ, мы не можем определить, являются ли они соматически мутированными или представляют собой новые гены зародышевой линии.

Ранее мы наблюдали, что гибридомы R4A против дцДНК от неаутоиммунных мышей демонстрируют отсутствие аллельного исключения, тогда как трансген, экспрессирующий гибридомы, не связывающиеся с дцДНК, демонстрируют интактное аллельное исключение (17). Поэтому мы исследовали гибридомы R4A против dsDNA от мышей NZB / W F1 на экспрессию эндогенной тяжелой цепи μ, γ1, γ3 или γ2a. Супернатанты гибридом анализировали с помощью ELISA на связывание с антиизотипическими антителами.Было обнаружено, что большинство гибридом (14 из 16) экспрессируют эндогенную тяжелую цепь, а также тяжелую цепь R4A-γ2b. В девяти гибридомах эндогенная тяжелая цепь имеет изотип μ; в 5 – изотипа γ3 или γ2a. Все гибридомы, не демонстрирующие исключения аллелей, продемонстрировали экспрессию второго изотипа, определяемую считыванием OD, которое было по меньшей мере в пять раз выше фоновых уровней (OD 405 нм > 0,6). Две гибридомы от мышей NZB / W F1, BW10D9 и BW7E6, не продемонстрировали связывания выше фона с анти-μ, γ1, γ3 или γ2a (OD 405 нм <0.150), предполагая, что они сохраняли аллельное исключение или что они секретировали эндогенную тяжелую цепь γ2b.

Сравнение репертуара легких цепей кодируемых трансгеном антител против дцДНК, используемых неаутоиммунными и аутоиммунными мышами (таблица 1), демонстрирует статистически значимое преобладание легких цепей Vk1 в гибридомах от неаутоиммунных мышей BALB / c и NZW. Чтобы понять, чем антитела к ДНК R4A-Vk1 могут отличаться от антител к ДНК R4A, не относящихся к Vk1, мы сравнили связывание с дцДНК с помощью ELISA (рис.5). Сходный спектр связывания присутствовал среди антител с легкими цепями как Vk1, так и не-Vk1. Некоторые антитела, не относящиеся к Vk1, демонстрируют более низкое связывание дцДНК, чем антитела Vk1, демонстрируя, что антитела, не относящиеся к Vk1, не представляют субпопуляцию с более высокой аффинностью. Мы также измерили кажущуюся аффинность некоторых репрезентативных антител против дцДНК Vk1 и не-Vk1 в анализе ингибирования ДНК (20). Не было различий в диапазоне аффинностей между Vk1 и не-Vk1 анти-dsDNA антителами (таблица 2).Одно антитело, которое только умеренно хорошо связывается с планшетами, покрытыми дцДНК (BW16B2) с помощью прямого ELISA, по-видимому, имеет более высокую очевидную аффинность, обнаруженную с помощью ELISA по ингибированию ДНК, чем ожидалось. Это антитело может лучше связываться с ДНК в растворе, чем с ДНК в твердой фазе, что характерно для некоторых антител против ДНК, которое наблюдалось ранее (22).

Поскольку сообщалось, что В-клетки со специфичностью к оцДНК толерантны за счет индукции анергии, в то время как В-клетки, связывающие дцДНК, удаляются (8), мы проанализировали перекрестную реактивность с оцДНК с помощью ELISA (таблица 3).При концентрации 2 мкг / мл одно антитело против дцДНК Vk1, BA129B-1, полученное от мыши BALB / c, и два не-Vk1 антитела против дцДНК, BW14C7B1 и BW9B5F7, полученные от мыши F1 NZB / W, прочно связываются с оцДНК (таблица 3) относительно R4A. Два других антитела против дцДНК, одно от мыши BALB / c и одно от мыши NZB / W F1, показывают менее чем двукратное увеличение связывания оцДНК по сравнению с R4A. Остальные антитела против дцДНК как от аутоиммунных, так и от неаутоиммунных мышей демонстрируют связывание с оцДНК менее чем в два раза больше, чем связывание R4A.

Для проверки на патогенность мышам SCID инъецировали линию клеток, экспрессирующую Vk1, NZW145-D2, полученную от трансгенной мыши NZW, и линию, не экспрессирующую Vk1, BW7E6h2, полученную от трансгенной мыши NZB / W F1. NZW145D-2 и BW7E6h2 были выбраны для исследований патогенности, поскольку обе клеточные линии аллельно исключены и секретируют только трансгенное антитело. Кроме того, антитела из обеих гибридом имеют сходные характеристики связывания.Оба они умеренно хорошо связываются с дцДНК с помощью ELISA (рис. 5), и оба имеют константы диссоциации в диапазоне 10 -9 -10 -8 , как определено с помощью анализа связывания с фильтром (21). Через 3 недели у этих мышей удаляли почки и окрашивали на предмет отложения антител. В обоих случаях отложение IgG наблюдалось в клубочках (фиг. 6, B и C ), что позволяет предположить, что как Vk1, так и не-Vk1 R4A антитела против дцДНК обладают патогенным потенциалом.

Антитела против дцДНК представляют собой основную патогенную специфичность при СКВ.Чтобы понять их регуляцию у неаутоиммунных и аутоиммунных хозяев, мы создали мышей, экспрессирующих тяжелую цепь патогенного антитела против дцДНК IgG2b. Эта тяжелая цепь, экспрессируемая в сочетании с репертуаром эндогенных легких цепей, может образовывать антитела с различным сродством к дцДНК. Анализ сыворотки и гибридом от трансгенных мышей R4A позволяет сделать несколько важных наблюдений.

Первое наблюдение состоит в том, что имеется дефект индукции толерантности у трансгенных мышей NZB / W F1, приводящий к повышенным титрам сыворотки трансгенных антител против дцДНК γ2b в этом аутоиммунном штамме.У аутоиммунных мышей MRL / lpr, которые имеют дефект в гене Fas, Roark et al. аналогичным образом наблюдали нарушение толерантности к трансгенным антителам против дцДНК (23) и предположили, что потеря Fas может привести к накоплению аутореактивных В-клеток. Однако другие исследования продемонстрировали интактную регуляцию трансгенных аутоантител у мышей MRL / lpr, что позволяет предположить, что Fas не важен для поддержания толерантности к В-клеткам (24, 25). Исследования на трансгенных мышах NZB / W F1 могут помочь нам определить, какие факторы, помимо снижения экспрессии Fas, могут привести к нарушению толерантности у мышей с предрасположенностью к аутоиммунным заболеваниям.

Второе наблюдение заключается в том, что трансгенные антитела против дцДНК, полученные от мышей NZB / W F1, часто кодируются немутантными генами легкой цепи. 3 из 5 гена Vk1 не мутированы у мышей NZB / W F1 по сравнению с 1 из 17 у мышей BALB / c и NZW. Хотя исследования антител против дцДНК от нетрансгенных мышей NZB / W F1 показывают, что гены антител подвергаются соматической мутации, имеется мало информации о том, приводят ли мутации к специфичности к дцДНК или кодируется ли аутореактивность зародышевой линией.Возможно, что аутореактивные В-клетки, специфичность которых закодирована зародышевой линией, ускользают от регуляции в костном мозге и выходят на периферию, где они затем приобретают соматические мутации после активации аутоантигенами. Таким образом, есть два возможных объяснения того факта, что аутоантитела, полученные от нетрансгенных мышей NZB / W F1, являются соматически мутированными; либо мутации необходимы для автоспецифичности, либо мутации происходят в уже аутореактивных В-клетках, которые не являются толеризованными. Наши исследования показывают, что у трансгенных мышей NZB / W F1 анти-дцДНК В-клетки, возникающие в костном мозге, могут перемещаться в периферические лимфоидные органы и секретировать аутоантитела, кодируемые зародышевой линией.Более того, активация В-клеток происходит без молекулярных свидетельств помощи Т-лимфоцитов.

Третье наблюдение из наших исследований заключается в том, что трансген, экспрессирующий гибридомы анти-дцДНК как из неаутоиммунных, так и из аутоиммунных штаммов, обнаруживает отсутствие аллельного исключения. В гибридомах, происходящих из NZW и BALB / c, большинство эндогенных антител не связываются с дцДНК. Ранее мы предполагали, что эндогенная тяжелая цепь способствует выживанию аутореактивных В-клеток (17).В гибридомах, производных от NZB / W F1, однако, эндогенная тяжелая цепь может проявлять специфичность связывания ДНК (Spatz, L., В. Саенко и Б. Даймонд, неопубликованные наблюдения). Следовательно, причина отсутствия аллельного исключения у трансгенных мышей NZB / W F1 неясна. Хотя было показано, что многие анти-дцДНК В-клетки, присутствующие у нетрансгенных мышей NZB / W F1, демонстрируют интактное аллельное исключение, частота неаллелически исключенных аутореактивных В-клеток у этих мышей не исследовалась. На В-клетках мышей MRLlpr / lpr, трансгенных по анти-ДНК-антителам, было продемонстрировано, что аллельное исключение чаще отсутствует, чем в В-клетках из неаутоиммунных трансгенных штаммов (26).Возможно, существует внутренний дефект B-клеток как в MRL / lpr, так и в B-клетках NZB / W F1, так что продукция трансгенной тяжелой цепи не может эффективно подавлять дальнейшие перестройки тяжелой цепи.

Четвертое и главное наблюдение состоит в том, что антитела против дцДНК от неаутоиммунных мышей предпочтительно используют легкие цепи Vk1, тогда как антитела, полученные от аутоиммунных мышей, кодируются широким спектром генов Vk.Это открытие предполагает, что аутореактивные В-клетки, экспрессирующие не-Vk1 легкие цепи, удалены из неаутоиммунных штаммов и что использование легкой цепи влияет на судьбу клеток. Дальнейшее подтверждение делеции В-клеток не-Vk1-R4A у неаутоиммунных мышей получено из исследований мышей BALB / c, трансгенных как по R4A-γ2b, так и по bcl-2. У этих мышей есть трансгенные В-клетки антиДНК в селезенке, экспрессирующие широкий спектр генов Vk (Kuo, P. и B. Diamond, неопубликованные наблюдения).

Снижение использования Vk1 у мышей NZB / W F1 не связано с аномалией в локусе гена легкой цепи κ мышей NZB.Продукция аутоантител наблюдалась во многих различных гаплотипах Igk-V, и ПДРФ-анализ не смог идентифицировать определенные гены Igk-V, связанные с волчанкой (27). Предыдущие исследования предполагают, что локусы гена Igk-V в линиях аутоиммунных мышей являются нормальными (28) и Gavalchin et al. продемонстрировали, что V-области, кодирующие набор патогенных анти-ДНК-антител у мышей с предрасположенностью к волчанке (NZB × SWR) F1, часто происходят от неаутоиммунного родительского штамма SWR (1). Аллельные полиморфизмы существуют среди отдельных генов легкой цепи из разных инбредных штаммов.Однако это не может объяснить преобладающее использование легких цепей Vk1-A среди антител против дцДНК, полученных от трансгенных мышей BALB / c, и их относительную малочисленность среди трансгенных антител против дцДНК, полученных от мышей NZB / W F1, поскольку идентичный Vk1-A ген присутствует в обоих штаммах (29). Более того, маловероятно, что доминирующая экспрессия генов Vk1 антителами против дцДНК, полученными от неаутоиммунных трансгенных мышей, является следствием предвзятого использования генов Vk1 в клетках, экспрессирующих трансген R4A-γ2b.Ни одно из 19 случайно выбранных R4A-γ2b-экспрессирующих, не связывающихся с ДНК антител из гибридом NZW не экспрессирует легкую цепь Vk1 (17). Таким образом, преобладающая экспрессия антител против дцДНК против Vk1 демонстрирует, что анти-ДНК В-клетки с легкими цепями, отличными от Vk1, нацелены на делецию в неаутоиммунных штаммах.

Чтобы понять, почему Vk1-экспрессирующие B-клетки уходят на периферию и сохраняются в неактивированном, молчащем состоянии, тогда как не-Vk1 B-клетки подвергаются делеции в неаутоиммунных штаммах, мы искали различия в связывании с dsDNA, которые могли бы объяснить их дифференциальную регуляцию.В то время как современные модели толерантности В-клеток предполагают, что взаимодействия с низкой авидностью с антигеном приводят к анергии, в то время как взаимодействия с высокой авидностью приводят к делеции, антитела против дцДНК Vk1 и не-Vk1 демонстрируют сходное сродство к дцДНК. Следовательно, различие в регуляции, по-видимому, не связано с различием в аффинности к дцДНК. Также различие в регуляции не коррелирует с различиями в патогенном потенциале этих антител. Клеточные линии, секретирующие антитело против дцДНК Vk1 и не-Vk1, инъецировали мышам SCID, и оба антитела откладывались в клубочках.

Об относительном вкладе легких цепей каппа в специфичность ДНК сообщалось ранее (30, 31). Radic et al. продемонстрировали, что соединение тяжелой цепи анти-ДНК 3H9 с различными легкими цепями изменяет способность антитела связывать дцДНК, кардиолипин и РНК, хотя все антитела сохраняют способность связывать оцДНК (31). Совсем недавно Retter et al. предположил, что легкая цепь может придавать антителу вторую перекрестно-реактивную специфичность (32).Мы предполагаем, что, возможно, именно на основе специфичности, связанной со второй легкой цепью, В-клетки, продуцирующие антитела против дцДНК R4A, либо делетируются, либо заглушаются. Чтобы начать проверку этой гипотезы, мы измерили связывание гибридомных антител с оцДНК. Хотя мы идентифицировали несколько антител, которые прочно связываются с оцДНК, мы не наблюдали какой-либо тенденции, которая могла бы объяснить дифференциальную регуляцию антител против Vk1 и не-Vk1. Фактически, два из этих антител используют гены, не относящиеся к Vk1, и, по-видимому, удалены у неаутоиммунных мышей, а не анергированы, как можно было бы ожидать.

Простейшая интерпретация наших исследований состоит в том, что ДНК не является критическим антигеном, опосредующим отбор этих аутореактивных В-клеток. Появляется все больше доказательств того, что антитела против ДНК могут перекрестно реагировать с несколькими другими аутоантигенами, включая фибронектин, ламинин, гепарансульфат, коллаген и кардиолипин, а также с ядерными антигенами (33–37). Если бы дцДНК была критическим отбором антигена, и только занятость рецептора определяла судьбу клетки, тогда как Vk1, так и не-Vk1 B-клетки подвергались бы одной и той же форме отрицательного отбора.Так же, как недавние данные повышают вероятность того, что анти-ДНК-антитела могут опосредовать повреждение тканей путем связывания перекрестно-реактивных антигенов, анти-ДНК-В-клетки могут регулироваться перекрестно-реактивными антигенами.

Эта трансгенная модель предоставляет уникальную возможность изучить молекулярные основы дифференциальной регуляции аутореактивных В-клеток и предполагает, что сродство к дцДНК не является критическим фактором, определяющим судьбу В-клеток против дцДНК.Если дцДНК действительно является аутоантигеном, способным опосредовать отрицательный отбор, наши данные предполагают, что связывание антигена на мембране В-клетки может задействовать рецепторный комплекс В-клетки для удаления или инактивации аутореактивных В-клеток в зависимости от свойств, не коррелирующих со сродством к антигену. . Более вероятно, что различные легкие цепи, связанные с тяжелой цепью R4A, опосредуют связывание с перекрестно-реактивными антигенами, и эта перекрестная реактивность играет роль в определении судьбы аутореактивных В-клеток против дцДНК.Идентичность этих предполагаемых перекрестно-реактивных антигенов еще предстоит определить в будущих исследованиях.

Некролог Джеймса Роберта Делани – Бронкс, Нью-Йорк

ПОЖАЛУЙСТА, ВНИМАТЕЛЬНО ПРОЧИТАЙТЕ СЛЕДУЮЩИЕ УСЛОВИЯ ПЕРЕД ИСПОЛЬЗОВАНИЕМ ДАННОГО ВЕБ-САЙТА (как определено ЗДЕСЬ). Используя этот веб-сайт, вы подтверждаете свое согласие с настоящими Условиями. Если вы не согласны с этими Положениями и условиями, НЕ используйте этот Веб-сайт (как определено в данном документе).

Настоящие Условия и положения регулируют использование веб-сайтов Book Of Memories («Веб-сайт»). и другие услуги (совместно именуемые «Услуги»). FrontRunner Professional («Компания», «мы», «нас», «наш») оставляет за собой право прямо в нашем по собственному усмотрению изменять, дополнять или модифицировать («изменения») все или часть настоящих Положений и условий в любое время и время ко времени по любой причине.Любые изменения в настоящих Условиях будут отмечены указанием даты, когда они Условия и положения были заключены последний раз. Любые изменения вступают в силу не ранее, чем через четырнадцать (14) дней после их публикации; при условии, однако, что изменения, касающиеся новых функций Сервисов, или изменения, внесенные по юридическим причинам, будут иметь силу немедленно. Ваше использование или дальнейшее использование Услуг после даты вступления в силу любых таких изменений будет означать ваше явное согласие с измененными, исправленными или модифицированными Условиями.

Право на участие: Пользователи младше 18 лет не имеют права использовать Услуги без согласия. Пользователи в возрасте от 13 до 17 лет могут использовать Сервисы с согласия и под надзором родителей или законных лиц. опекун, достигший 18-летнего возраста; при условии, однако, что такой родитель или законный опекун соглашается быть связаны настоящими Условиями, и соглашается нести ответственность за такое использование Услуг.Компания оставляет за собой право отказать в использовании Услуги кому угодно и отвергать, отменить, прервать, удалить или приостановить любую Кампанию, Пожертвование или Услуги в любое время по любой причине без обязанность.

Определения: В настоящих Условиях «Организаторы кампании» означают лиц, собирающих средства, и «Кампании» как их кампании по сбору средств. Кроме того, «Доноры» означают тех, кто вносит средства, и «Пожертвования» как средства, которые они вносят.Организаторы кампании, доноры и другие посетители Сервисов вместе именуются «Пользователи». Термин «Организаторы кампании» также включает в себя любое лицо (лица), указанное в качестве бенефициара Кампании.

Услуги: Услуги предлагаются в качестве платформы («Платформа») Пользователям Услуг. Помимо других функций, Сервисы предназначены для того, чтобы позволить организаторам кампаний публиковать кампании. Платформе для приема пожертвований от доноров.Хотя за создание кампаний плата не взимается, часть каждого пожертвования будет взиматься в качестве платы за наши Услуги и за оплату нашей третьей стороной процессоры. Компания оставляет за собой право изменять или прекращать, временно или постоянно, Услуги с или без уведомление. Вы соглашаетесь с тем, что Компания не будет нести ответственности перед вами или любой третьей стороной за любые изменения, приостановку или их прекращение.Компания не несет ответственности за удаление или невозможность хранения каких-либо данных или другого контента. поддерживается или загружается Сервисами. Если вы получаете доступ к Сервисам через мобильное устройство, стандарт вашего оператора беспроводной связи обвинения, может взиматься плата за передачу данных и другие сборы. Кроме того, загрузка, установка или использование определенных Сервисов может быть запрещено или ограничено вашим оператором связи, и не все Службы могут работать со всеми операторами связи или устройствами.Используя Сервисы, вы соглашаетесь с тем, что мы можем общаться с вами в отношении Компании и других лиц с помощью SMS, MMS, текстовых сообщений или других электронных средств на ваш мобильное устройство и что определенная информация об использовании Услуг может быть передана нам.

Благотворительные пожертвования: Кампании не являются благотворительными организациями, в которые вы можете направлять благотворительные цели, не облагаемые налогом. взносы.Любое пожертвование, которое вы делаете через Платформу, может быть обработано неаффилированным деловым партнером, для которого разовая комиссия (в дополнение к нашему вознаграждению за работу с FrontRunner Professional). Вы понимаете, признаете и соглашаетесь с тем, что Компания не является благотворительная деятельность, Компания не требует благотворительных пожертвований для себя или сторонних благотворительных организаций. Компания просто выступает в качестве посредника по оплате любых пожертвований.

Только административная платформа: Услуги являются только административной платформой. Компания просто выступает в качестве посредника по оплате любых пожертвований между Организаторами Кампании и Донорами, и не является стороной каких-либо соглашений между Организаторами Кампании и Донорами. Компания , а не брокер, агент финансовое учреждение, кредитор или страховщик для любого пользователя. Компания не контролирует проведение, или любую информацию, предоставленную Организаторами кампании, и Компания настоящим снимает с себя всякую ответственность в этом отношении.Мы прямо отказываемся от какой-либо ответственности за успех или результат любой Кампании. Доноры должны по своему собственному усмотрению принимать окончательное решение о внесении пожертвований на какие-либо кампании. Доноры несут исключительную ответственность за вопросы и расследование Организаторов Кампании и Кампаний. в той степени, в которой они считают это необходимым, прежде чем делать взнос. Все пожертвования делаются добровольно и по собственному усмотрению и на риск Доноров.Компания не гарантирует, что пожертвования будут использованы в качестве обещал. Компания не подтверждает, не дает гарантий, не делает заявлений и не предоставляет гарантий в отношении качества или качества, безопасность, или законность любой Кампании. Доноры несут единоличную ответственность за определение того, как относиться к своим пожертвованиям для уплаты налогов. целей.

Нет проверки информации о кампании: Мы не проверяем информацию, которую организаторы кампании поставлять, и не гарантируют, что пожертвования будут использованы в соответствии с какой-либо целью сбора средств, предписанной Организаторы кампании.Мы не несем ответственности за проверку того, используются ли пожертвования в соответствии с какими-либо применимые законы.

Ваши регистрационные обязательства: Вам может потребоваться зарегистрироваться в Компании, чтобы получить доступ и использовать определенные функции Сервисов. Если вы решите зарегистрироваться для использования Сервисов, вы соглашаетесь предоставлять и поддерживать достоверные, точные, актуальные и полная информация о самостоятельно в соответствии с запросом в регистрационной форме Служб.Организаторы кампании должны зарегистрироваться, используя свои истинные идентичности, включая их имя и любое изображение, предназначенное для изображения Организатора кампании. Регистрационные данные и некоторые Дополнительная информация о вас регулируются нашей Политикой конфиденциальности. Если вам меньше 13 лет, вы не имеете права использовать Услуги, с регистрацией или без нее. Кроме того, если вам меньше 18 лет, вы можете использовать Сервисы с регистрацией или без нее, только с одобрение вашего родителя или опекуна.Некоторые аспекты наших Услуг также могут потребовать от вас регистрации (и согласия с условиями) третьей стороны. поставщики услуг (например, обработчики платежей или обработчики благотворительных пожертвований) для использования таких Сервисов. Хотя в некоторых случаях мы можем помочь облегчить такую ​​регистрацию, мы не участвуем ни в каких таких отношениях и отказываются от какой-либо ответственности или обязательств за исполнение таким третьим лицом стороны.Мы можем обмениваться информацией с такими сторонними службами, чтобы облегчить предоставление Услуг (и связанных сторонних услуг).

Публичная демонстрация пожертвований: Доноры имеют возможность публично демонстрировать свои пожертвования для общественности просмотр или разрешить их информация, которая должна быть предоставлена ​​бенефициару (ям) Кампании. Чтобы детали вашего пожертвования оставались конфиденциальными, просто нажмите соответствующий флажок во время процесса пожертвования.Пожалйста, ознакомьтесь с нашими условиями конфиденциальности для получения дополнительной информации о способах сбора, использования и хранения определенной информации о вас и вашем использовании Услуг.

Выплата пожертвований: Чтобы внести свой вклад в Кампанию, Доноры должны будут предоставить Компании информация относительно свою кредитную карту (например, VISA, MasterCard, Discover или American Express) или другой способ оплаты. Доноры представлять и гарантировать Компания утверждает, что такая информация верна и что Доноры имеют право использовать кредитную карту или способ оплаты.Доноры соглашаются с тем, что может применяться определенная минимальная сумма пожертвования, и что все пожертвования являются окончательными и не подлежат возврату. Доноры соглашаются незамедлительно обновить информацию об учетной записи с учетом любых изменений, которые могут произойти, и внести указанную вами сумму пожертвования. Доноры настоящим разрешают Компания будет регулярно выставлять счета по кредитным картам и способам оплаты доноров до тех пор, пока доноры не прекратят свое действие. периодические платежи через Платформу.

Сборы: Компания не взимает с организаторов кампании никаких авансовых платежей за проведение кампаний. Компания сохраняет часть каждого пожертвования внес свой вклад в Кампании в размере четырех процентов (4%) («Вознаграждение FrontRunner Professional»). Часть пожертвования составляет выплачивается нашему третьему сторонние платежные системы («Плата за обработку»). Доноры признают, что, делая пожертвования в кампании, Доноры соглашаются любые и все применимые положения и условия, установленные сторонней платежной системой, в дополнение к этим Условия и положения.Доля каждого пожертвования, подлежащая уплате и удерживаемая нашими сторонними платежными системами, составляет:

• ТОЛЬКО для пользователей из США: сторонняя платежная система взимает комиссию в размере 2,9% И 0,30 доллара США за пожертвование на VISA, Карты MasterCard или Discover или 3,4% И 0,30 доллара США за пожертвование для карт American Express.

• ТОЛЬКО для пользователей CA: сторонняя платежная система взимает комиссию в размере 2.9% И 0,30 доллара США за пожертвование на VISA, Карты MasterCard или Discover или 3,4% И 0,30 доллара США за пожертвование для карт American Express.

Все сборы за вознаграждение и сборы за обработку («Сборы») вычитаются непосредственно из каждого пожертвования и не отражено в сумме какие Организаторы Кампании могут выйти из Кампании. Мы оставляем за собой право изменять любую комиссию с время от времени. Если мы изменим какие-либо сборы, мы предоставим уведомление об изменении на Веб-сайте или иным образом, по нашему выбору, не менее чем за четырнадцать (14) дней до того, как изменение вступит в силу.Ваше дальнейшее использование Услуг после изменение в вступление в силу любой из Комиссий означает ваше согласие с новой Комиссией.

Компенсация: Вы соглашаетесь освободить, освободить и удерживать Компанию и ее аффилированные лица и их владельцев, офицеры, сотрудники, директора и агенты безвредны от любых потерь, убытков, расходов, в том числе разумных гонорары адвокатов, права, претензии, причины исков, действия любого рода и травмы (включая смерть), возникшие в связи с вашим использование Сервисов, любое пожертвование или кампанию, нарушение вами настоящих Положений и условий или нарушение вами любых прав Другой.Если вы являетесь жителем Калифорнии, вы отказываетесь от действия Раздела 1542 Гражданского кодекса Калифорнии, который гласит: “ОБЩИЕ РАЗРЕШЕНИЯ НЕ РАСПРОСТРАНЯЮТСЯ НА ПРЕТЕНЗИИ, КОТОРЫЕ КРЕДИТОР НЕ ЗНАЕТ И НЕ ПРЕДПОЛАГАЕТ, ЧТО СУЩЕСТВУЕТ В ЕГО ИЗБИРАТЕЛЬСТВАХ ВО ВРЕМЯ ВЫПОЛНЕНИЯ ВЫПУСКА, КОТОРЫЕ, ЕСЛИ ЕГО ИЗВЕСТНО, ДОЛЖНЫ Существенно повлиять на его расчет с должником “. Если вы являетесь резидентом другой юрисдикции, вы отказываетесь от любого сопоставимого закона или доктрины.

ОТКАЗ ОТ ЗАЯВЛЕНИЙ И ГАРАНТИЙ: ВЫ ИСПОЛЬЗУЕТЕ УСЛУГУ НА СВОЙ ИСКЛЮЧИТЕЛЬНЫЙ РИСК.УСЛУГА ПРЕДОСТАВЛЯЕТСЯ НА УСЛОВИЯХ «КАК ЕСТЬ» И «ПО ДОСТУПНОСТИ». КОМПАНИЯ И ЕЕ ФИЛИАЛЫ ЯВНО ОТКАЗЫВАЕТСЯ ОТ ОТВЕТСТВЕННОСТИ ВСЕ ГАРАНТИИ ЛЮБОГО ВИДА, ЯВНЫХ, ПОДРАЗУМЕВАЕМЫХ ИЛИ ЗАКОНОДАТЕЛЬНЫХ УСЛОВИЙ, ВКЛЮЧАЯ, НО НЕ ОГРАНИЧИВАясь ПОДРАЗУМЕВАЕМЫМИ ГАРАНТИЯМИ КОММЕРЧЕСКОЙ ЦЕННОСТИ, ПРИГОДНОСТЬ ДЛЯ КОНКРЕТНОЙ ЦЕЛИ, НАЗВАНИЕ И НЕ НАРУШЕНИЕ ПРАВ. КОМПАНИЯ И ЕЕ ФИЛИАЛЫ НЕ ДАЮТ НИКАКИХ ГАРАНТИЙ, ЧТО УСЛУГИ БУДУТ ОТВЕЧАТЬ ВАШИМ ТРЕБОВАНИЯМ, УСЛУГИ БУДУТ НЕПРЕРЫВНЫМИ, СВОЕВРЕМЕННЫМИ, БЕЗОПАСНЫМИ ИЛИ БЕЗОШИБОЧНЫМИ РЕЗУЛЬТАТАМИ, КОТОРЫЕ МОГУТ БЫТЬ ПОЛУЧЕНЫ ИЗ ИСПОЛЬЗОВАНИЕ УСЛУГ БУДЕТ ТОЧНОЕ ИЛИ НАДЕЖНОЕ ПЕРЕДАЧА ЛЮБОГО Жертвования ИЛИ ИХ ЧАСТИ ПОЛУЧАТЕЛЮ ЛЮБЫХ КАМПАНИЙ ИЛИ КАЧЕСТВО ЛЮБЫХ УСЛУГ.

ОГРАНИЧЕНИЕ ОТВЕТСТВЕННОСТИ: ВЫ ЯВНО ПОНИМАЕТЕ И СОГЛАШАЕТЕСЬ, ЧТО НИ КОМПАНИЯ ИЛИ ЕЕ ФИЛИАЛЫ НЕ БУДУТ НЕСЕТ ОТВЕТСТВЕННОСТЬ ЗА ЛЮБЫЕ КОСВЕННЫЕ, СЛУЧАЙНЫЕ, ОСОБЫЕ, КОСВЕННЫЕ, ПРИМЕРНЫЕ УБЫТКИ ИЛИ УБЫТКИ ПО УБЫТКЕ ПРИБЫЛИ, ВКЛЮЧАЯ, НО НЕ ОГРАНИЧЕННАЯ К, УБЫТКИ, СВЯЗАННЫЕ С УБЫТОМ, ИСПОЛЬЗОВАНИЕМ, ДАННЫМИ ИЛИ ДРУГИМИ НЕМАТЕРИАЛЬНЫМИ УБЫТКАМИ (ДАЖЕ ЕСЛИ КОМПАНИЯ СООБЩАЛАСЬ ВОЗМОЖНОСТЬ ТАКИХ УБЫТКОВ), НА ОСНОВЕ ДОГОВОРА, ПРАВОНАРУШЕНИЯ, НЕБРЕЖНОСТИ, СТРОГОЙ ОТВЕТСТВЕННОСТИ ИЛИ ИНЫХ СЛУЧАЕВ В РЕЗУЛЬТАТЕ ИСПОЛЬЗОВАНИЯ ИЛИ НЕВОЗМОЖНОСТЬ ПОЛЬЗОВАТЬСЯ УСЛУГАМИ, НЕСАНКЦИОНИРОВАННОГО ДОСТУПА ИЛИ ИЗМЕНЕНИЯ ВАШИХ ПЕРЕДАЧ ИЛИ ДАННЫХ, ЗАЯВЛЕНИЙ ИЛИ ПОВЕДЕНИЯ ЛЮБЫХ ТРЕТЬИХ ВЕЧЕРИНКА ПО УСЛУГАМ, ИЛИ ЛЮБЫЕ ДРУГИЕ ВОПРОСЫ, КАСАЮЩИЕСЯ УСЛУГ.НИ ПРИ КАКИХ ОБСТОЯТЕЛЬСТВАХ КОМПАНИЯ НЕ НЕСЕТ ПОЛНОЙ ОТВЕТСТВЕННОСТИ ПЕРЕД ВАМИ ЗА ВСЕ УБЫТКИ, УБЫТКИ ИЛИ ПРИЧИНЫ ДЕЙСТВИЙ ПРЕВЫШАЮТ СУММУ, ВЫПЛАЧИВАЕМУЮ КОМПАНИИ ЗА ПОСЛЕДНИЕ ШЕСТЬ (6) МЕСЯЦЕВ, НО НИ В КОЕМ СЛУЧАЕ БОЛЕЕ СОТНИ ДОЛЛАРОВ (100 $).

ИСКЛЮЧЕНИЯ: В НЕКОТОРЫХ ЮРИСДИКЦИЯХ НЕ ДОПУСКАЕТСЯ ИСКЛЮЧЕНИЕ ОПРЕДЕЛЕННЫХ ГАРАНТИЙ ИЛИ ОГРАНИЧЕНИЙ ИЛИ ИСКЛЮЧЕНИЕ ОТВЕТСТВЕННОСТИ ЗА СЛУЧАЙНЫЕ ИЛИ КОСВЕННЫЕ УБЫТКИ. СОГЛАСНО, НЕКОТОРЫЕ ИЗ ОГРАНИЧЕНИЙ, УСТАНОВЛЕННЫХ ВНУТРИ ВЫШЕ МОЖЕТ НЕ ОТНОСИТЬСЯ К ВАМ.ЕСЛИ ВЫ НЕ УДОВЛЕТВОРЕНЫ ЛЮБОЙ ЧАСТЬЮ УСЛУГИ ИЛИ НАСТОЯЩИМИ УСЛОВИЯМИ, ВАШИ ЕДИНСТВЕННЫЕ И УСЛОВИЯ ИСКЛЮЧИТЕЛЬНОЕ СРЕДСТВО ПРЕКРАЩЕНИЯ – ПРЕКРАЩЕНИЕ ИСПОЛЬЗОВАНИЯ СЛУЖБЫ.

РАЗРЕШЕНИЕ СПОРОВ – АРБИТРАЖ (ПРОЧИТАЙТЕ ВНИМАТЕЛЬНО): Вы соглашаетесь рассматривать все споры и претензии в арбитраже между вами и компанией (включая наши соответствующие дочерние компании, филиалы, агентов, сотрудников, заинтересованных предшественников, правопреемников, и назначает).Несмотря на вышесказанное, любая из сторон может подать индивидуальный иск в суд мелких тяжб. Уведомление о Спор («Уведомление»). Уведомление компании должно быть отправлено по адресу 2501 Parmenter Street, Suite 300A, Middleton, WI 53562, Attn: Президент, с копией по электронной почте на адрес [email protected] («Адрес для уведомления»). Уведомление должно (i) описывать характер и основание претензии или спор, и (ii) изложить конкретное испрашиваемое возмещение («Требование»).Если Компания и вы не придете к соглашению о разрешить претензию в течение 60 (шестидесяти) дней после получения Уведомления вы или Компания можете начать арбитражное разбирательство. Во время арбитража, сумма любого предложения об урегулировании, сделанного Компанией или вами, не должна быть раскрыта арбитру до тех пор, пока арбитр определяет сумму, если таковая имеется, на которую вы или Компания имеете право.

Арбитраж будет регулироваться Правилами коммерческого арбитража и Дополнительными процедурами для Потребительские споры (совместно именуемые «Правила AAA») Американской арбитражной ассоциации («AAA») с изменениями, внесенными настоящими Условиями и Условия, и будут управляться AAA.Правила AAA доступны на сайте adr.org, позвонив в AAA по телефону 1-800-778-7879, или написав на адрес для уведомления. Арбитр обязан соблюдать положения настоящих Условий. Все вопросы должны решаться арбитром, включая, помимо прочего, вопросы, касающиеся объема, исполнимость, и арбитрабельность арбитражного положения. Если Компания и вы не договорились об ином, любой арбитраж слушания будут состоится в Чикаго, штат Иллинойс.Независимо от того, как проводится арбитраж, арбитр должен вынести мотивированное письменное решение, достаточное для объяснения существенных выводов и выводов, по которым награда основана. ВЫ И КОМПАНИЯ СОГЛАШАЕТЕСЬ, ЧТО КАЖДЫЙ МОЖЕТ ПОДАТЬ ПРЕТЕНЗИИ К ДРУГУ ТОЛЬКО В ВАШЕЙ ЛИЧНОСТИ ИЛИ ЕГО ЛИЧНОМ ВОЗМОЖНОСТИ, А НЕ В КАЧЕСТВЕ ОБЫЧНОГО ИЛИ КЛАССНОГО ЧЛЕНА В ЛЮБОМ ПРЕДПОЛАГАЕМОМ КЛАССЕ ИЛИ ПРЕДСТАВИТЕЛЬСКОМ ПРОЦЕССЕ. Если и вы, и Компания договориться об ином в письменной форме, арбитр не может объединять требования более чем одного лица и не может иначе председательствовать по любой форме представительского или группового производства.Если это конкретное положение будет признано не имеющим исковой силы, тогда это положение об арбитраже полностью недействительно.

Фамилия Саенко

Имя для Саенко

  • Ирина Саенко 6
  • Владимир Саенко 4
  • Лилия Саенко 4
  • Ира Саенко 4
  • Илья Саенко 4
  • Илона Саенко 4
  • 166 Игорь Глебко Саенко 4
  • 166 Игорь Глебко Саенко 4
  • Саенко 4
  • Геннадий Саенко 4
  • Гена Саенко 4
  • Галя Саенко 4
  • Галина Саенко 4
  • Вероника Саенко 3
  • Сергей Саенко 3
  • Серега
  • Саенко 3
  • Роман Саенко
  • Роман Саенко
  • Роман Саенко 3
  • Евгения Саенко 3
  • Екатерина Саенко 3
  • Андрей Саенко 3
  • Алена Саенко 3
  • Женя Саенко 2
  • Жанна Саенко 2
  • Юрий Саенко 2
  • Юрка 2
  • Юр 2
  • Юлия Саенко 2
  • Юлия Саенко 2
  • Ярослав Саенко 2
  • Яна Саенко 2
  • Вячеслав Саенко 2
  • Вова Саенко 2
  • Влад Саенко 2
  • Владислав Саенко 2
  • Витя Саенко 2
  • Вита Саенко 2
  • Виталий Саенко 2
  • Виталий Саенко 2
  • Виктор Саенко 2
  • Виктор Саенко 2
  • Саенко 2
  • Вика Саенко 2
  • Виктор Саенко 2
  • Виктория Саенко 2
  • Вера Саенко 2
  • Василий Саенко 2
  • Васил Саенко 2
  • Василий Саенко 2
  • Валерия 6
  • Валерия 6 Саенко 2
  • Валерия Саенко 2
  • Валера Саенко 2
  • Валентин Саенко 2
  • Валентина Саенко 2
  • Вадим Саенко 2
  • Тима Саенко 2
  • Тедди Саенко 2
  • Саенко 2 Саенко 2
  • Тедди Саенко 2
  • Саенко
  • Татьяна 2
  • Саенко 2
  • Тата Саенко 2
  • Таня Саенко 2
  • Таня Саенко 2
  • Светлана Саенко 2 9 0166
  • Светик Саенко 2
  • Света Саенко 2
  • Сувит Саенко 2
  • Степан Саенко 2
  • Соня Саенко 2
  • София Саенко 2
  • Сергей Саенко 2
  • Саенко 2
  • Саша6 Саенко 2
  • Саша6 Саенко
  • Рома Саенко 2
  • Полина Саенко 2
  • Пикуль Саенко 2
  • Петр Саенко 2
  • Павел Саенко 2
  • Паша Саенко 2
  • Оксана Саенко 2
  • Саенко 2
  • 9016 Оля Саенко 2
  • 9016 Оля Саенко 2
  • Олег Саенко 2
  • Нина Саенко 2
  • Ник Саенко 2
  • Николай Саенко 2
  • Николай Саенко 2
  • Никита Саенко 2
  • Николь Саенко 2
  • Ник
  • Наташа 2 9016 Назена 2 9016
  • Наталья Саенко 2
  • Наталья Саенко 2
  • Наталия Саенко 2
  • Натали Саенко 2
  • Натали Саенко 2
  • Наталья Саенко 2
  • Надя Саенко 2
  • Надежда Саенко 2
  • Мила Саенко 2
  • Михаил Саенко 2
  • Михаил Саенко 2
  • Макс Саенко 2
  • Максим Саенко 2
  • Саенко 2
  • Максим Саенко 2
  • Мария Саенко 2
  • Маргарита Саенко 2
  • Максим Саенко 2
  • Людмила Саенко 2
  • Любовь Саенко 2
  • Людмила Саенко 2
  • Лиза Саенко 2
  • Саенко 2
  • Люд 5
  • Люд 5
  • Леонид Саенко 2
  • Лена Саенко 2
  • Лариса Саенко 2
  • Лара Саенко 2
  • Лана Саенко 2
  • Ксения Саенко 2
  • Ксения Саенко 2
  • Ксения Саенко 2
  • Ксения Саенко 2
  • Ксения
  • Ксения
  • Саенко
  • Константин Саенко 2
  • Коля Саенко 2
  • Кирилл Саенко 2
  • Катя Саенко 2
  • Катя Саенко nko 2
  • Катя Саенко 2
  • Катеруна Саенко 2
  • Катерина Саенко 2
  • Юлия Саенко 2
  • Юлия Саенко 2
  • Яна Саенко 2
  • Иван Саенко 2
  • Иришка 2
  • Иришка 2
  • Иришка Саенко 2
  • Инна Саенко 2
  • Инесс Саенко 2
  • Илия Саенко 2
  • Ифа Саенко 2
  • Гриша Саенко 2
  • Герман Саенко 2
  • Герасим Саенко 2
  • Георгий Саенко 2
  • Георгий Саенко 2
  • Георгий Саенко 2
  • Георгий Саенко 2
  • Саенко 2
  • Геннадий Саенко 2
  • Галина Саенко 2
  • Гала Саенко 2
  • Евгений Саенко 2
  • Евгений Саенко 2
  • Евгений Саенко 2
  • Евгения Саенко 2 9016 9016 Саенко 2
  • Евгения Саенко 2
  • Саенко 2
  • Евгения Саенко 2
  • Саенко 2
  • Дмитрий Саенко 2
  • Дмитрий Саенко 2
  • Дима Саенко 2
  • Диана Саенко 2
  • День Саенко 2
  • Денис Саенко 2
  • Даша Саенко 2
  • Дарья Саенко 2
  • Дарья Саенко 2
  • Даниил Саенко 2
  • Дана Саенко 2
  • Кристина Саенко 2
  • Борис Бэдн 2
  • Ася Саенко 2
  • Артем Саенко 2
  • Анжелика Саенко 2
  • Анюта Саенко 2
  • Аня Саенко 2
  • Антон Саенко 2
  • Антонина Саенко 2
  • 9016 9016 Анна Саенко 2
  • Анатолий Саенко 2
  • Анастасия Саенко 2
  • Анастасия Саенко 2
  • Анастасия Саенко 2
  • Алла Саенко 2
  • Алиса Саенко 2
  • Алексей
  • Алина
  • Саенко 2 9016 Алиса
  • Алина
  • Саенко 2 906 6 2
  • Алексей Саенко 2
  • Александр Саенко 2
  • Александра Саенко 2
  • Александр Саенко 2 90 166
  • Алексей Саенко 2
  • Александр Саенко 2
  • Александра Саенко 2
  • Александр Саенко 2
  • Александр Саенко 2
  • Альбина Саенко 2
  • Зоя Саенко
  • Зина Саенко
  • Зина
  • Зина Саенко
  • Зина
  • Юрий Саенко
  • Yulichka Саенко
  • Юлиан Саенко
  • Yroslav Саенко
  • Yra Саенко
  • Ярославы Саенко
  • Яник Саенко
  • Всеволод Саенко
  • Wlad Саенко
  • Wadik Саенко
  • Владимир Саенко
  • Vladirmir Саенко
  • Вячеслав Саенко
  • Витос Саенко
  • Виталия Саенко
  • Виталик Саенко
  • Виолета Саенко
  • Вилена Саенко
  • Виктория Саенко
  • Виктор Саенко 9016 Викторья Саенко 9016 Виктор Саенко 9016 Виктория Саранко 9016 9016 Виктория Саранко 9016 ika Saenko
  • Veniamin Saenko
  • Vasya Saenko
  • Vasuliu Saenko
  • Vasilina Saenko
  • Vanya Saenko
  • Valto Saenko
  • Valeriy Saenko
  • Valerij 9016
  • Thatsani Саенко
  • Tatyna Саенко
  • Tati Саенко
  • Тарас Саенко
  • Танюша Саенко
  • Tanushka Саенко
  • Светлане Саенко
  • Svarogh Саенко
  • Стася Саенко
  • Станислав Саенко
  • Sofy Саенко
  • Славик Саенко
  • Шон Саенко
  • Шелли Саенко
  • Сергей Саенко
  • Серг Саенко
  • Сергей Саенко
  • Серджио Саенко
  • Сергей Саенко
  • Семен Саенко
  • Саенко 9016 Саенко 9016 Саенко 9016 Сашаен 9016 Сашаен 9016 Сашаен 9016 Сашаен 9016
  • Sanek Saenko
  • Saenkoanna Saenko
  • Sabrin Saenko
  • Ryslan Saenko
  • Rusya Saenko
  • Rungnapha Saenko
  • Roza Saenko
  • Rodrigo Saenko 9016 Saenko 9016 Peter Saenko 9016 Саенко
  • Педро Саенко
  • Павел Саенко
  • Пакинай Саенко
  • Олюся Саенко
  • Оля Саенко
  • Алексей Саенко
  • Александр Саенко
  • Оки Саенко 9016 Саенко 9016 Саенко 9016 Саенко 905 9016 Саенко 9016 Нин Саенко 9016
  • Никитка Саенко
  • Неля Саенко
  • Нелля Саенко
  • Нелли Саенко
  • Нела Саенко
  • Натусай Саенко
  • Натка Саенко
  • Натик Саенко 9016 Натал Саенко
  • Натик Саенко
  • Натал Саенко
  • Natalija Саенко
  • Nataha Саенко
  • Nanney Саенко
  • Nana Саенко
  • Nadya Саенко
  • Nadin Саенко
  • Михайло Саенко
  • Mwinyiza Саенко
  • Миша Саенко
  • Mike Саенко
  • Miika Саенко
  • Мишель Саенко
  • Михаил Саенко
  • Майкл Саенко
  • Микаэла Саенко
  • Меруи Саенко
  • Матвей Саенко
  • Мария Саенко
  • Марина Саенко
  • Марина Саенко
  • Маришка Саенко 905 Саенко 905 Марри Саенко
  • Маришка Саенко 905 Марришка Саенко 905
  • Макс Саенко
  • Майкл Саенко
  • Любовь Саенко
  • Лыба Саенко
  • Лукас Саенко
  • Люда Саенко
  • Любовь Саенко
  • Лола 9016 Саенко 9016 Лола 9016 Саенко
  • Лола 9016 Саенко
  • Lexx Saenko
  • Lesya Saenko
  • Lesia Saenko
  • Lerusik Saenko
  • Lerok Saenko
  • Lenuska Saenko
  • Leah Saenko
  • Lariska Saenko 9016 Saenko
  • Saenko 905 Саенко
  • Косты Саенко
  • Костик Саенко
  • Клим Саенко
  • Кирюха Саенко
  • Кирко Саенко
  • Кира Саенко
  • Кетрин Саенко
  • Катяна Саенко 9016 Кесорн Саенко
  • Кататиа Саенко 9016 Кесорн Саенко
  • 9016 Кесорн Саенко 9016
  • Карине Саенко
  • Июль Саенко
  • Юлианна Саенко
  • Женя Саенко
  • Елена Саенко
  • Исаяс Саенко
  • Ивга Саенко
  • Иванна Саенко
  • Саенко Саенко Саенко Саенко Саенко Guy Saenko
  • Gulia Saenko
  • Gosha Saenko
  • Fedya Saenko
  • Fedor Saenko
  • Evgeni Saenko
  • Eva Saenko
  • Eugene Saenko
  • eliza 9016 Saenko 9016 Saenko 9016 Elya
  • Элина Саенко
  • Ehdita Саенко
  • Дмитрий Саенко
  • Djein Саенко
  • Димитрий Саенко
  • Диман Саенко
  • Denys Саенко
  • Дэнс Саенко
  • Димитрий Саенко
  • Дашуля Саенко
  • Дарина Саенко
  • Данила Саенко
  • Екатерина Саенко
  • Бова Саенко
  • Борислава Саенко
  • Бекир Саенко
  • Атрем Саенко
  • Артур Саенко
  • Артур Саенко
  • Арсений Саенко
  • Саенко
  • Саенко
  • Саенко
  • Саенко
  • Аррисена
  • Анзелика Саенко
  • Anyta Saenko
  • Ann Saenko
  • Anika Saenko
  • Angel Saenko
  • Angelok Saenko
  • Anfisa Saenko
  • Anechka Saenko 9016 Saenko 9016 9016 Andry 905 Andry 9016 Andry 9016 Saenko
  • 9016 Andry 905 Andry 9016 Саенко
  • Анастасия Саенко
  • Анастаси Саенко
  • Анам Саенко
  • Алена Саенко
  • Алвес Саенко
  • Алсу Саенко
  • Аллочка Саенко
  • Saenko
  • Аллочка Саенко 9016 Миссенко
  • Аллочка Саенко
  • Миссенко
  • Алиона 6 Аллочка Саенко
  • Алиона 6 Алиона seanko, saneko, saenk, saenkoa, ssenko, saenkoe, saenkoi, saenkoo, saennko

    Лучшие изображения для Saenko

    похожие имена

    Saenkod / Saenkom / Saenkong / Saenkoon / Saenkort / Saenkot / Na1060 / Saenkoteenko / Каенко / Гаенко / Хаенко / Баенко / Каенко / Ра enko

    Локус FOXE1 является основным генетическим детерминантом радиационной карциномы щитовидной железы в Чернобыле | Молекулярная генетика человека

    Аннотация

    Папиллярный рак щитовидной железы (PTC) среди лиц, подвергшихся воздействию радиоактивного йода в детстве или подростковом возрасте, является серьезным международно признанным последствием аварии на Чернобыльской АЭС для здоровья.Для выявления генетических детерминант, влияющих на индивидуальную восприимчивость к радиационно-зависимым ПТК, мы провели полногеномное ассоциативное исследование с участием белорусских пациентов с ПТК в возрасте 0–18 лет на момент аварии и белорусских контрольных субъектов того же возраста. Были выполнены две серии сканирований генома с использованием независимых наборов образцов, и была оценена связь с радиационно-зависимым ПТК. Мета-анализ методом Mantel – Haenszel, объединяющий два исследования, выявил четыре SNP на хромосоме 9q22.33, демонстрирующие значительную связь с заболеванием (Mantel – Haenszel P : mhp = 1,7 × 10 –9 до 4,9 × 10 –9 ). Связь была дополнительно усилена валидационным анализом с использованием одного из этих маркеров SNP, rs3, с новым набором образцов (общий mhp = 4,8 × 10 –12 , OR = 1,65, 95% CI: 1,43–1,91). Rs3 расположен на 57 т.п.н. выше FOXE1 , тироид-специфического транскрипционного фактора, играющего ключевую роль в морфогенезе щитовидной железы, и недавно был зарегистрирован как самый сильный генетический маркер риска спорадических ПТК в европейских популяциях.Интересно, что не было получено никакой связи между радиационным PTC и rs9 (mhp = 0,17) в 14p13.3, который показал вторую по значимости связь со спорадическим PTC у европейцев. Эти результаты показывают, что сложный путь, лежащий в основе патогенеза, может частично разделяться двумя этиологическими формами PTC, но их генетические компоненты не полностью перекрывают друг друга, что позволяет предположить наличие других неизвестных специфических по этиологии генетических детерминант в связанных с радиацией PTC.

    ВВЕДЕНИЕ

    Чернобыльская авария в апреле 1986 года привела к радиоактивному загрязнению огромных территорий в Беларуси, Украине и России.Миллионы жителей подверглись воздействию широкого спектра радионуклидов, из которых 131 I было основным дозообразующим изотопом для щитовидной железы. С начала 1990-х годов сообщалось о резком увеличении заболеваемости раком щитовидной железы среди лиц, подвергшихся воздействию в детском или подростковом возрасте. Его специфическое временное и географическое распределение наводило на мысль об общем причинном событии в развитии злокачественного новообразования (1, 2), которое позже было доказано внутренним воздействием 131 I через его включение в пищевые цепи пастбищных коров и дальнейшее потребление. свежего молока (3).В 2002 г. число диагностированных случаев рака щитовидной железы в трех наиболее пострадавших странах приблизилось к 5000, из которых 75% можно отнести к чернобыльской радиации (2, 4).

    Среди множества гистологических типов рака щитовидной железы только папиллярная карцинома щитовидной железы (PTC) демонстрирует явную дозозависимую дозу облучения и составляет около 95% случаев после Чернобыльской аварии (3, 5, 6). Радиация – единственный известный фактор риска окружающей среды для ПТК, наблюдаемый как после внешнего (7), так и после внутреннего облучения (5).Риск рака щитовидной железы у лиц, подвергшихся облучению в молодом возрасте, остается повышенным на протяжении всей их жизни. Хотя роль предрасполагающих факторов, обычно связанных со спорадическим ПТК для женского пола, менее актуальна в случаях ПТК, связанного с радиацией, сообщалось о соотношении женщин и мужчин 1,6: 1 (8). Кроме того, связанный с радиацией PTC также варьируется с точки зрения продолжительности латентного периода, самый ранний из которых, как сообщается, составляет 4 года (1). Также остается неясным, почему, несмотря на существенно сопоставимые дозы облучения щитовидной железы у больных Чернобыльской ПТК и у здоровых людей того же возраста и из одних и тех же населенных пунктов (3, 9, 10), злокачественные новообразования щитовидной железы развиваются только у небольшой части облученных.Таким образом, хотя доза облучения и молодой возраст на момент облучения являются хорошо установленными факторами риска ПТК, наблюдения наводят на мысль о существовании генетических факторов и сложных взаимодействий между генами и окружающей средой, которые могут модулировать индивидуальную чувствительность к радиации и восприимчивость к радиационно-зависимым ПТК.

    Чтобы определить генетические детерминанты, которые изменяют индивидуальную предрасположенность к радиационно-зависимым злокачественным новообразованиям щитовидной железы, мы провели исследование полногеномной ассоциации (GWA). Две серии сканирований генома были выполнены с использованием двух независимых наборов выборок, состоящих из детей, страдающих РТС из Беларуси, и контрольных субъектов, после чего было проведено валидационное исследование с использованием третьего набора случайных и контрольных образцов.Всего было набрано 667 пациентов, которым был поставлен диагноз PTC в 1989–2009 гг., И 827 контрольных пациентов соответствующего возраста из тех же регионов, что составило самую большую группу пациентов, проанализированных на сегодняшний день. Кроме того, результаты сканирования генома 448 российских образцов ДНК также были включены в общий контроль популяции.

    РЕЗУЛЬТАТЫ

    Исследование GWA

    При первоначальном сканировании генома (названном «Исследование 1») в общей сложности 532 024 аутосомных маркера SNP 187 пациентов с ПТК и 172 контрольной группы были выбраны для исследования ассоциации случай – контроль после контроля качества результатов генотипирования (Таблица 1).Средняя частота вызовов на маркер SNP и образец ДНК составила 0,999 и 0,999 соответственно. Не наблюдалось сильного отклонения коэффициента инфляции между группами случая и контрольной группой (фактор инфляции геномного контроля λ = 1,08, дополнительные материалы, рис. S1a). Статистический анализ, сравнивающий распределение генотипов, не обнаружил маркеров SNP, которые показали бы значимость для всего генома. В последующем сканировании генома (названном «Исследование 2») 214 случаев были изучены в рамках ассоциативного анализа после контроля качества, и распределение генотипов 509 610 маркеров SNP было сравнено с распределением генотипов 448 российских контрольных групп населения.В исследовании 2 средняя частота вызовов на маркер SNP и образец ДНК составляла 0,998 и 0,980 соответственно. Небольшое увеличение λ-значения геномного контроля наблюдалось между группой случая и контрольной группой (коэффициент инфляции геномного контроля λ = 1,14, дополнительные материалы, рис. S1b и S2), что, скорее всего, связано с внутрироссийскими субструктурами в российских популяционных контролях. . Опять же, не было маркеров SNP, которые показали бы значимость для всего генома.

    Таблица 1.

    Характеристики образцов ДНК, использованных для исследования

  • Исследование . Набор образцов . Классификация . Номер . Возраст при воздействии
    .
    Возраст на момент постановки диагноза
    .
    . . . . Диапазон . Среднее ± стандартное отклонение . Диапазон . Среднее ± стандартное отклонение .
    Исследование 1 PTC1 Случаи 187 0-17 3,0 ± 3,8 3-20 10,0 ± 4,1
    CTR 0-17 1,5 ± 2,8
    Исследование 2 PTC2 Случаи 214 0-17 5.8 ± 5,2 2-22 13,9 ± 5,5
    CTR2 Элементы управления а 448 910TC Корпуса 259 0-18 6,8 ± 5,5 3-22 16,5 ± 4,4
    CTR3 Controls 648 0-26 6.2 ± 5.9
  • Исследование . Набор образцов . Классификация . Номер . Возраст при воздействии
    .
    Возраст на момент постановки диагноза
    .
    . . . . Диапазон . Среднее ± стандартное отклонение . Диапазон . Среднее ± стандартное отклонение .
    Исследование 1 PTC1 Случаи 187 0-17 3,0 ± 3,8 3-20 10,0 ± 4,1
    CTR 0-17 1,5 ± 2,8
    Исследование 2 PTC2 Случаи 214 0-17 5.8 ± 5,2 2-22 13,9 ± 5,5
    CTR2 Элементы управления а 448 910TC Корпуса 259 0-18 6,8 ± 5,5 3-22 16,5 ± 4,4
    CTR3 Controls 648 0-26 6.2 ± 5.9
    Таблица 1.

    Спецификация образцов ДНК, использованных для исследования

  • 9
  • 971111 .TC анализ мета-анализа was239 предпринята путем интеграции генотипов, полученных в исследовании 1 и исследовании 2. Связь с радиационно-зависимым ПТК была оценена с использованием метода Mantel – Haenszel для 506 840 маркеров SNP, которые прошли контроль качества в обоих исследованиях. Распределение значений mhp по хромосомам показано на рисунке 1.Небольшое увеличение значения λ наблюдалось между случаем и контролем (λ = 1,11, дополнительный материал, рис. S1c). Кластер из четырех SNP на хромосоме 9q22.23 показал значимость для всего генома ( P <5,0 × 10 -8 ), а именно rs9, rs7850258, rs3 и rs10759944 с метаанализом P -значения 1,7 × 10 −9 , 1,7 × 10 −9 , 4,9 × 10 −9 и 3,5 × 10 −9 соответственно (рис.2 и таблица 2). Эти маркеры находятся в сильном неравновесном сцеплении (LD) друг с другом (попарно D ‘> 0.999, r 2 > 0,999). Хотя не было соседних SNP, показывающих более сильные сигналы (дополнительный материал, таблица S1), девять других маркеров в том же хромосомном локусе показали предполагающие сигналы ассоциации (mhp = 5,2 × 10 -4 до 1,4 × 10 -6 ) (таблица 2). Кроме того, мы изучили ассоциацию путем объединения генотипов, полученных в исследованиях 1 и 2. После поправки на стратификацию населения с помощью Eigenstrat, а также на остаточную инфляцию методом геномного контроля, все четыре маркера, которые показали общегеномную значимость в метаанализе. были немного ниже уровня значимости для всего генома (rs7850258: P = 1.5 × 10 −7 , rs9: P = 1,5 × 10 −7 , rs10759944: P = 2,4 × 10 −7 , rs3: P = 3,2 × 10 −7 ) .

    Таблица 2.

    Результаты анализа ассоциации для маркеров SNP на 9q22.33 и 14q13.3 с использованием когорты чернобыльского детского рака щитовидной железы

    Исследование . Набор образцов . Классификация . Номер . Возраст при воздействии
    .
    Возраст на момент постановки диагноза
    .
    . . . . Диапазон . Среднее ± стандартное отклонение . Диапазон . Среднее ± стандартное отклонение .
    Исследование 1 PTC1 Случаи 187 0-17 3,0 ± 3,8 3-20 10,0 ± 4,1
    CTR 0-17 1.5 ± 2,8
    Исследование 2 PTC2 Случаи 214 0-17 5,8 ± 5,2 2-22 13,911 ± 5,5
  • Controls a 448
    Исследование 3 PTC3 Случаи 259 0 -8 ± 5,5 3 – 22 16,5 ± 4,4
    CTR3 Контрольные элементы 648 0-26 6,2 ± 5,9
    Набор образцов . Классификация . Номер . Возраст при воздействии
    .
    Возраст на момент постановки диагноза
    .
    . . . . Диапазон . Среднее ± стандартное отклонение . Диапазон . Среднее ± стандартное отклонение .
    Исследование 1 PTC1 Случаи 187 0-17 3,0 ± 3,8 3-20 10.0 ± 4,1
    CTR1 Элементы управления 172 0-17 1,5 ± 2,8
    Исследование 2 PTC2 CTR 5,8 ± 5,2 2 – 22 13,9 ± 5,5
    CTR2 Элементы управления a 448 Ящики 259 0-18 6.8 ± 5,5 3 – 22 16,5 ± 4,4
    CTR3 Контроли 648 0 – 26 6,2 ± 5,9
    Маркер . Аллель а
    .
    Chr . Позиция . Статистика по исследованиям
    .
    Исследование 1 + 2
    .
    Исследование 1 + 2 + 3
    .
    Gudmundsson et al.
    .
    . Арт. . Вар . . . Исследование . Freq var. . Trend P b . OR (95% ДИ) c . л.с. d . OR (95% ДИ) c . л.с. d . OR (95% ДИ) c . Freq var. . P -значение e . OR (95% ДИ) c .
    . . . . . . Чемодан . Контроль . . . . . . . Чемодан . Контроль . . .
    rs1512261 G * T 9 9
    51 1 0,500 0,419 0,0299116 0,0299111 1,3118 1,3119 1,53 (1,27, 1,84) 01137 2509 0,391 5,2 × 10 −5 1,62 (1,28, 2,04)
  • 383838 9 901 1 0,706 0,610 0,010 1,53 (1,12, 2,09) 5,2 × 10 −4 1,40 (1,16, 1.69) 2 0,697 2 0,697 0,697 0,611 rs9 C * T 9 92138 1487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 1,7 × 10 −9 1,79 (1,48, 2,16)37373837383738 2 0,481 0,349 6,0 × 10 −6 1,73 (1,37, 2,18)3838 rs7850258 A * G 9 934 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 1,7 × 10 −9 1,79 (1,48, 2,16)37373837383738 2 0,481 0,349 6,0 × 10 −6 1,73 (1,37, 2,18)11383838 rs3 A * G 9 995 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 4,9 × 10 −9 1,76 (1,45, 2,12) 4,8 × 10 −12 (1,43, 1,91) 0,490 0,352 6,8 × 10 −20 1,77 (1,57, 2,00)37373737373738 1.7 × 10 −5 1,68 (1,33, 2,12)38 0,367 2,0 × 10 −4 1,48 (1,20,1,83)38
  • 99
  • 99
  • 99
  • 99 993 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 3,5 × 10 −9 1,77 (1,46, 2,14) 0,490 1,7 × 10 −19 1,77 (1,57, 2,01) 2 0,479 0,352 −56000 15555600069 (1,34, 2,14) rs7848973 A * 938 0,0032 1,56 (1,16, 2,10) 2,5 × 10 −6 1,56 (1,29, 1,87)14 2 0.502 0,393 2,0 × 10 −4 1,56 (1,24, 1,97)383838 9 959 1 0,380 0,305 0,038 1,39 (1,02, 1,90) 1,4 × 10 −6 1,63 (1,33, 1.98) 0,387 0,285 1,9 × 10 −12 1,58 (1,39, 1,80)3737 4,0 × 10 −6 1,75 (1,37, 2,23)37 93834 93834 93834 9384 900 1 0.487 0,392 0,012 1,47 (1,09, 1,97) 2,6 × 10 −4 1,41 (1,17, 1,70) 0,488 0,385 0,488 0,385 911 1,52 (1,32, 1,74) 2 0,477 0,398 0,0070 1,3119 rs
  • 0 T * C 9 918 1 0.374 0,314 0,10 1,30 (0,96, 1,78) 5,7 × 10 −6 1,58 (1,30, 1,92) 0,395 0,395 0,281 911 1,66 (1,46, 1,89) 2 0,396 0,273 4,2 × 10 −6 2,1123) rs7 C * T111911 1,45 (1,08, 1,96) 4,5 × 10 −5 1,47 (1,22, 1,77) 0,472 0,359 2.6 × 10 −13 1.60 (1.41, 1.81) 2 0,465 0,369 0,465 0,369 9117 911 9119 , 1.88) rs10984103 A * C383738373 0,372 0,015 1,45 (1,08, 1,96) 4,6 × 10 −5 1,47 (1,22, 1,77) 0,472 −0,359 10,359 1,59 (1,41, 1,81) 2 0,465 0,369 9,5 × 10 −4617, 1.87) rs7866436 G * A 1,49 (1,10, 2,00) 5,2 × 10 −5 1,47 (1,22, 1,76)38383838383838 2 0.463 0,372 0,0016 1,46 (1,15, 1,84) 1 0,626 0,580 0,23 1,21 (0,90, 1,63) 0,17 1,13 (0,95, 1,36) 0.644 0,558 2,5 × 10 −8 1,44 (1,26, 1,63) 2 0,60711 0,60711 0,81 , 1,40)
    Маркер . Аллель а
    .
    Chr . Позиция . Статистика по исследованиям
    .
    Исследование 1 + 2
    .
    Исследование 1 + 2 + 3
    .
    Gudmundsson et al.
    .
    . Арт. . Вар . . . Исследование . Freq var. . Trend P b . OR (95% ДИ) c . л.с. d . OR (95% ДИ) c . л.с. d . OR (95% ДИ) c . Freq var. . P -значение e . OR (95% ДИ) c .
    . . . . . . Чемодан . Контроль . . . . . . . Чемодан . Контроль . . .
    rs1512261 G * T 9 9
    51 1 0,500 0,419 0,0299116 0,0299111 1,3118 1,3119 1,53 (1,27, 1,84) 01137 2509 0,391 5,2 × 10 −5 1,62 (1,28, 2,04)
  • 383838 9 901 1 0,706 0,610 0,010 1,53 (1,12, 2,09) 5,2 × 10 −4 1,40 (1,16, 1.69) 2 0,697 2 0,697 0,697 0,611 rs9 C * T 9 92138 1487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 1,7 × 10 −9 1,79 (1,48, 2,16)37373837383738 2 0,481 0,349 6,0 × 10 −6 1,73 (1,37, 2,18)3838 rs7850258 A * G 9 934 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 1,7 × 10 −9 1,79 (1,48, 2,16)37373837383738 2 0,481 0,349 6,0 × 10 −6 1,73 (1,37, 2,18)11383838 rs3 A * G 9 995 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 4,9 × 10 −9 1,76 (1,45, 2,12) 4,8 × 10 −12 (1,43, 1,91) 0,490 0,352 6,8 × 10 −20 1,77 (1,57, 2,00)37373737373738 1.7 × 10 −5 1,68 (1,33, 2,12)38 0,367 2,0 × 10 −4 1,48 (1,20,1,83)38
  • 99
  • 99
  • 99
  • 99 993 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 3,5 × 10 −9 1,77 (1,46, 2,14) 0,490 1,7 × 10 −19 1,77 (1,57, 2,01) 2 0,479 0,352 −56000 15555600069 (1,34, 2,14) rs7848973 A * 938 0,0032 1,56 (1,16, 2,10) 2,5 × 10 −6 1,56 (1,29, 1,87)14 2 0.502 0,393 2,0 × 10 −4 1,56 (1,24, 1,97)383838 9 959 1 0,380 0,305 0,038 1,39 (1,02, 1,90) 1,4 × 10 −6 1,63 (1,33, 1.98) 0,387 0,285 1,9 × 10 −12 1,58 (1,39, 1,80)3737 4,0 × 10 −6 1,75 (1,37, 2,23)37 93834 93834 93834 9384 900 1 0.487 0,392 0,012 1,47 (1,09, 1,97) 2,6 × 10 −4 1,41 (1,17, 1,70) 0,488 0,385 0,488 0,385 911 1,52 (1,32, 1,74) 2 0,477 0,398 0,0070 1,3119 rs
  • 0 T * C 9 918 1 0.374 0,314 0,10 1,30 (0,96, 1,78) 5,7 × 10 −6 1,58 (1,30, 1,92) 0,395 0,395 0,281 911
    1,66 (1,46, 1,89) 2 0,396 0,273 4,2 × 10 −6 2,1123) rs7 C * T111911 1,45 (1,08, 1,96) 4,5 × 10 −5 1,47 (1,22, 1,77) 0,472 0,359 2.6 × 10 −13 1.60 (1.41, 1.81) 2 0,465 0,369 0,465 0,369 9117 911 9119 , 1.88) rs10984103 A * C383738373 0,372 0,015 1,45 (1,08, 1,96) 4,6 × 10 −5 1,47 (1,22, 1,77) 0,472 −0,359 10,359 1,59 (1,41, 1,81) 2 0,465 0,369 9,5 × 10 −4617, 1.87) rs7866436 G * A 1,49 (1,10, 2,00) 5,2 × 10 −5 1,47 (1,22, 1,76)38383838383838 2 0.463 0,372 0,0016 1,46 (1,15, 1,84) 1 0,626 0,580 0,23 1,21 (0,90, 1,63) 0,17 1,13 (0,95, 1,36) 0.644 0,558 2,5 × 10 −8 1,44 (1,26, 1,63) 2 0,60711 0,60711 0,81 , 1.40) Таблица 2.

    Результаты ассоциативного анализа для маркеров SNP на 9q22.33 и 14q13.3 с использованием когорты чернобыльского детского рака щитовидной железы

    Маркер . Аллель а
    .
    Chr . Позиция . Статистика по исследованиям
    .
    Исследование 1 + 2
    .
    Исследование 1 + 2 + 3
    .
    Gudmundsson et al.
    .
    . Арт. . Вар . . . Исследование . Freq var. . Trend P b . OR (95% ДИ) c . л.с. d . OR (95% ДИ) c . л.с. d . OR (95% ДИ) c . Freq var. . P -значение e . OR (95% ДИ) c .
    . . . . . . Чемодан . Контроль . . . . . . . Чемодан . Контроль . . .
    rs1512261 G * T 9 9
    51 1 0.500 0,419 0,029 1,39 (1,03, 1,87) 6,9 × 10 -6 1,53 (1,27, 1,84)3838383838383838 2 0,509 0,391 5,2 × 10 −5 1,62 (1,28, 2,04)383838383838 rs1877432 G * A 9 901 1 0.706 0,610 0,010 1,53 (1,12, 2,09) 5,2 × 10 −4 1,40 (1,16, 1,69)383838383838 2 0,697 0,628 0,016 1,36 (1,06, 1,74)383838383837 938 * Т 9 921 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 1,7 × 10 −9 1,79 (1,48, 2,16)37373837383738 2 0,481 0,349 6,0 × 10 −6 1,73 (1,37, 2,18)3838 rs7850258 A * G 9 934 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 1,7 × 10 −9 1,79 (1,48, 2,16)37373837383738 2 0,481 0,349 6,0 × 10 −6 1,73 (1,37, 2,18)11383838 rs3 A * G 9 995
    1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 4,9 × 10 −9 1,76 (1,45, 2,12) 4,8 × 10 −12 (1,43, 1,91) 0,490 0,352 6,8 × 10 −20 1,77 (1,57, 2,00)37373737373738 1.7 × 10 −5 1,68 (1,33, 2,12)38 0,367 2,0 × 10 −4 1,48 (1,20,1,83)38
  • 99
  • 99
  • 99
  • 99 993 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 3,5 × 10 −9 1,77 (1,46, 2,14) 0,490 1,7 × 10 −19 1,77 (1,57, 2,01) 2 0,479 0,352 −56000 15555600069 (1,34, 2,14) rs7848973 A * 938 0,0032 1,56 (1,16, 2,10) 2,5 × 10 −6 1,56 (1,29, 1,87)14 2 0.502 0,393 2,0 × 10 −4 1,56 (1,24, 1,97)383838 9 959 1 0,380 0,305 0,038 1,39 (1,02, 1,90) 1,4 × 10 −6 1,63 (1,33, 1.98) 0,387 0,285 1,9 × 10 −12 1,58 (1,39, 1,80)3737 4,0 × 10 −6 1,75 (1,37, 2,23)37 93834 93834 93834 9384 900 1 0.487 0,392 0,012 1,47 (1,09, 1,97) 2,6 × 10 −4 1,41 (1,17, 1,70) 0,488 0,385 0,488 0,385 911 1,52 (1,32, 1,74) 2 0,477 0,398 0,0070 1,3119 rs
  • 0 T * C 9 918 1 0.374 0,314 0,10 1,30 (0,96, 1,78) 5,7 × 10 −6 1,58 (1,30, 1,92) 0,395 0,395 0,281 911 1,66 (1,46, 1,89) 2 0,396 0,273 4,2 × 10 −6 2,1123) rs7 C * T111911 1,45 (1,08, 1,96) 4,5 × 10 −5 1,47 (1,22, 1,77) 0,472 0,359 2.6 × 10 −13 1.60 (1.41, 1.81) 2 0,465 0,369 0,465 0,369 9117 911 9119 , 1.88) rs10984103 A * C383738373 0,372 0,015 1,45 (1,08, 1,96) 4,6 × 10 −5 1,47 (1,22, 1,77) 0,472 −0,359 10,359 1,59 (1,41, 1,81) 2 0,465 0,369 9,5 × 10 −4617, 1.87) rs7866436 G * A 1,49 (1,10, 2,00) 5,2 × 10 −5 1,47 (1,22, 1,76)38383838383838 2 0.463 0,372 0,0016 1,46 (1,15, 1,84) 1 0,626 0,580 0,23 1,21 (0,90, 1,63) 0,17 1,13 (0,95, 1,36) 0.644 0,558 2,5 × 10 −8 1,44 (1,26, 1,63) 2 0,60711 0,60711 0,81 , 1,40)
    Маркер . Аллель а
    .
    Chr . Позиция . Статистика по исследованиям
    .
    Исследование 1 + 2
    .
    Исследование 1 + 2 + 3
    .
    Gudmundsson et al.
    .
    . Арт. . Вар . . . Исследование . Freq var. . Trend P b . OR (95% ДИ) c . л.с. d . OR (95% ДИ) c . л.с. d . OR (95% ДИ) c . Freq var. . P -значение e . OR (95% ДИ) c .
    . . . . . . Чемодан . Контроль . . . . . . . Чемодан . Контроль . . .
    rs1512261 G * T 9 9
    51 1 0,500 0,419 0,0299116 0,0299111 1,3118 1,3119 1,53 (1,27, 1,84) 01137 2509 0,391 5,2 × 10 −5 1,62 (1,28, 2,04)
  • 383838 9 901 1 0,706 0,610 0,010 1,53 (1,12, 2,09) 5,2 × 10 −4 1,40 (1,16, 1.69) 2 0,697 2 0,697 0,697 0,611 rs9 C * T 9 92138 1487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 1,7 × 10 −9 1,79 (1,48, 2,16)37373837383738 2 0,481 0,349 6,0 × 10 −6 1,73 (1,37, 2,18)3838 rs7850258 A * G 9 934 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 1,7 × 10 −9 1,79 (1,48, 2,16)37373837383738 2 0,481 0,349 6,0 × 10 −6 1,73 (1,37, 2,18)11383838 rs3 A * G 9 995 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 4,9 × 10 −9 1,76 (1,45, 2,12) 4,8 × 10 −12 (1,43, 1,91) 0,490 0,352 6,8 × 10 −20 1,77 (1,57, 2,00)37373737373738 1.7 × 10 −5 1,68 (1,33, 2,12)38 0,367 2,0 × 10 −4 1,48 (1,20,1,83)38
  • 99
  • 99
  • 99
  • 99 993 1 0.487 0,334 3,3 × 10 −5 1,89 (1,40, 2,55) 3,5 × 10 −9 1,77 (1,46, 2,14) 0,490 1,7 × 10 −19 1,77 (1,57, 2,01) 2 0,479 0,352 −56000 15555600069 (1,34, 2,14) rs7848973 A * 938 0,0032 1,56 (1,16, 2,10) 2,5 × 10 −6 1,56 (1,29, 1,87)14 2 0.502 0,393 2,0 × 10 −4 1,56 (1,24, 1,97)383838 9 959 1 0,380 0,305 0,038 1,39 (1,02, 1,90) 1,4 × 10 −6 1,63 (1,33, 1.98) 0,387 0,285 1,9 × 10 −12 1,58 (1,39, 1,80)3737 4,0 × 10 −6 1,75 (1,37, 2,23)37 93834 93834 93834 9384 900 1 0.487 0,392 0,012 1,47 (1,09, 1,97) 2,6 × 10 −4 1,41 (1,17, 1,70) 0,488 0,385 0,488 0,385 911 1,52 (1,32, 1,74) 2 0,477 0,398 0,0070 1,3119 rs
  • 0 T * C 9 918 1 0.374 0,314 0,10 1,30 (0,96, 1,78) 5,7 × 10 −6 1,58 (1,30, 1,92) 0,395 0,395 0,281 911
    1,66 (1,46, 1,89) 2 0,396 0,273 4,2 × 10 −6 2,1123) rs7 C * T111911 1,45 (1,08, 1,96) 4,5 × 10 −5 1,47 (1,22, 1,77) 0,472 0,359 2.6 × 10 −13 1.60 (1.41, 1.81) 2 0,465 0,369 0,465 0,369 9117 911 9119 , 1.88) rs10984103 A * C383738373 0,372 0,015 1,45 (1,08, 1,96) 4,6 × 10 −5 1,47 (1,22, 1,77) 0,472 −0,359 10,359 1,59 (1,41, 1,81) 2 0,465 0,369 9,5 × 10 −4617, 1.87) rs7866436 G * A 1,49 (1,10, 2,00) 5,2 × 10 −5 1,47 (1,22, 1,76)38383838383838 2 0.463 0,372 0,0016 1,46 (1,15, 1,84) 1 0,626 0,580 0,23 1,21 (0,90, 1,63) 0,17 1,13 (0,95, 1,36) 0.644 0,558 2,5 × 10 −8 1,44 (1,26, 1,63) 2 0,60711 0,60711 0,81 , 1,40)

    Рисунок 1.

    Манхэттенский график объединенных результатов GWAS для исследований 1 и 2. P -значения, рассчитанные с помощью теста Trend χ 2 для 506 840 аутосомных SNP, нанесены на шкалу −log 10 относительно их хромосомных положений. Горизонтальная линия показывает скорректированный по Бонферрони P = 9,6 × 10 −8 .

    Рисунок 1.

    Манхэттенский график объединенных результатов GWAS для исследований 1 и 2. P -значения, рассчитанные с помощью теста Trend χ 2 для 506 840 аутосомных SNP, нанесены в шкале −log 10 относительно к их хромосомным позициям.Горизонтальная линия показывает скорректированный по Бонферрони P = 9,6 × 10 −8 .

    Рисунок 2.

    Схематическая организация локуса FOXE1 человека в 9q22.23 с результатами сканирования генома. Значения Mhp, рассчитанные с помощью теста Trend χ 2 в шкале −log 10 , были нанесены на красные кружки для SNP, расположенных в области 425 kb между rs4742698 и rs4618817 на хромосоме 9q22.23. Синий кружок указывает значение mhp rs3 по результатам метаанализа с использованием объединенных результатов исследования 1 и исследования 3.Структура и ориентация восьми генов в регионе показаны под графиками с их транскрипционной ориентацией в соответствии с NCBI Reference Sequence Build 36.3. Блоки LD были созданы в соответствии с парными оценками LD для SNP, расположенных в регионе, с использованием результатов сканирования генома в исследовании 1 и исследовании 2.

    Рисунок 2.

    Схематическая организация локуса FOXE1 человека в 9q22.23 с результаты сканирования генома. Значения Mhp, рассчитанные с помощью теста Trend χ 2 в шкале −log 10 , были нанесены на красные кружки для SNP, расположенных в области 425 kb между rs4742698 и rs4618817 на хромосоме 9q22.23. Синий кружок указывает значение mhp rs3 по результатам метаанализа с использованием объединенных результатов исследования 1 и исследования 3. Структура и ориентация восьми генов в регионе показаны под графиками с их транскрипционной ориентацией в соответствии с эталонной последовательностью NCBI. Сборка 36.3. Блоки LD были сгенерированы в соответствии с парными оценками LD для SNP, расположенных в пределах региона, с использованием результатов сканирования генома в исследовании 1 и исследовании 2.

    маркеров SNP, расположенных на X-хромосоме, были протестированы на ассоциацию в отдельном анализе.Случаи и контроль были разделены на мужчин и женщин, и был проведен ассоциативный анализ. В результате ни один из маркеров не показал полногеномной значимости (mhp> 3,6 × 10 −5 для мужчин, mhp> 1,6 × 10 −5 для женщин).

    Исследование по валидации

    Область 425 т.п.н. между rs4742698 и rs4618817, охватывающая эти маркеры, была оценена на предмет структуры LD с результатами генотипирования исследования 1 и исследования 2. Были идентифицированы три блока LD: блок A между rs4742698 и rs162, блок B между rs1512261 и rs10818094 и блок C между RS7871887 и RS4618817.Все четыре наиболее значимых маркера находятся в блоке B (рис. 2). Вблизи этих SNP локализованы восемь генов: TMOD1 (код Entrez Gene ID: 7111), C9orf97 (ID: 158427), NCBP1 (ID: 4686), XPA (ID: 7507), KRT18P13 (ID: 3), FOXE1 (ID: 2304), C9orf156 (ID: 51531) и HEMGN (ID: 55363), но ни один из этих генов не находится в блоке B. Семь из девяти маркеров, показывающих предполагающие ассоциативные сигналы, расположены либо в 5 ‘, либо в 3’ фланкирующей области гена FOXE1 в блоке C.Кроме того, был проведен вмененный анализ для маркеров SNP в блоках A, B и C с использованием генотипов Международного проекта HapMap в качестве эталона. Мы определили три дополнительных SNP в блоке B, а именно rs7030280, rs10983700 и rs1588635, расположенных примерно в 9–11 т.п.н. по отношению к rs9, показывая аналогичные уровни ассоциации (условно P = 2,8 × 10 -9 для rs7030280 и rs10983700, условно рассчитано P = 3,7 × 10 −9 для rs1588635) (дополнительный материал, таблица S2).Никакие другие маркеры SNP в блоке A или C не достигли общегеномного значения.

    Эта область 9q22.23, содержащая ген FOXE1 (или TTF2 ), кодирующий тироид-специфический фактор транскрипции, была недавно идентифицирована как хромосомный локус, сильно связанный с предрасположенностью к спорадическому раку щитовидной железы в исландском исследовании (11). . Среди семи SNP, показывающих значимые ассоциации ( P <2,8 × 10 −9 ) у исландских спорадических пациентов с PTC, rs3 был самым сильным ( P = 6.8 × 10 −20 , OR = 1,77) (таблица 2). Поэтому мы выбрали rs3, расположенный на 57 т.п.н. выше FOXE1 , для дальнейшего генотипирования с помощью Taqman с использованием независимого набора образцов (названного «Исследование 3») из 259 случаев и 648 контролей (таблица 1). Сильная ассоциация ( P = 2,0 × 10 −4 ) была воспроизведена и дополнительно усилена, когда генотипы трех исследований были объединены для метаанализа (mhp = 4,8 × 10 −12 , OR = 1,65, 95% ДИ: 1,43–1.91).

    Совсем недавно другое генетическое исследование, посвященное 97 генам-кандидатам, опосредующим канцерогенез щитовидной железы, идентифицировало rs1867277 в 5′-UTR FOXE1 как генетическую детерминанту для спорадических PTC ( P = 5,9 × 10 -9 , OR = 1,49, 95% ДИ: 1,30–1,70) (12). Поскольку rs1867277 не был исследован в нашем исследовании, мы разработали зонд Taqman и генотипировали 660 случаев PTC (PTC1, PTC2 и PTC3) и 820 белорусских контролей (CTR1 и CTR3) (Таблица 1). Значительная связь была получена при значении P , равном 4.5 × 10 −7 и OR 1,48 (95% ДИ: 1,27–1,71).

    Генотипирование rs

    9 на хромосоме 14q13.3

    Rs9 на хромосоме 14q13.3 показал вторую по значимости ассоциацию со спорадическим PTC в исландской популяции ( P = 2,5 × 10 -8 , OR = 1,44, 95% ДИ: 1,26–1,63) (11). Этот SNP расположен в LD-области длиной 249 т.п.н., которая не содержит каких-либо известных генов, но находится рядом с TTF1 (ID: 7080), другим геном фактора транскрипции, специфичным для щитовидной железы.Мы исследовали, показывает ли rs9 значительную связь в результатах сканирования генома. Интересно, что он не смог показать какой-либо связи с радиационно-зависимым PTC ( P = 0,23 в исследовании 1, P = 0,43 в исследовании 2 и mhp = 0,17 по метаанализу) (таблица 2).

    Корреляция между генотипами rs

    3 и латентным периодом заболевания

    Считается, что рак щитовидной железы требует индукционного и латентного периода не менее 10 лет после воздействия ионизирующего излучения (13).Мы разделили 660 образцов случаев на две группы в зависимости от даты постановки диагноза в пределах или более 10 лет с момента радиоактивного заражения. В группе с ранним началом было 178 пациентов в возрасте от 3 до 25 лет (средний возраст ± стандартное отклонение: 11,2 ± 4,3 года), которым был поставлен диагноз в течение первых 10 лет (до 1997 г.), с латентным периодом 7,0 ± 1,9 года. В группе с поздним началом было 482 образца в возрасте от 10 до 39 лет (22,9 ± 7,5 лет), которым был поставлен диагноз после 1997 г., с латентным периодом 16,4 ± 3,8 года. Глядя на результаты для rs3, была обнаружена гораздо более сильная связь для случаев с ранним началом ( P = 2.0 × 10 −9 , OR = 1,97, 95% ДИ: 1,58–2,47), чем случаи с поздним началом ( P = 6,0 × 10 −8 , OR = 1,52, 95% ДИ: 1,31–1,77 ) по сравнению с 1268 контрольными объектами (от CTR1 до CTR3). Однако не было статистической значимости, чтобы доказать более сильное влияние rs3 на раннее начало PTC ( p – гетерогенность = 0,063).

    ОБСУЖДЕНИЕ

    В этом исследовании мы предприняли GWA-исследование связанных с радиацией ПТК с привлечением белорусских пациентов и контрольных субъектов.Мы идентифицировали четыре маркера сильной LD на хромосоме 9q22.23, которые были в значительной степени связаны с заболеванием. Сильная связь была также очевидна при выборе одного из этих маркеров, rs3, с генотипированием независимого набора образцов по Такману (общий mhp = 4,8 × 10 −12 , OR = 1,65, 95% CI: 1,43–1,91). . Rs3 был недавно идентифицирован как генетический фактор риска спорадического PTC у лиц европейского происхождения (11) и расположен в блоке LD, который лежит центромерным по отношению к FOXE1 .

    Другой недавний отчет показал сильную связь rs1867277 в 5′-UTR FOXE1 с риском дифференцированного рака щитовидной железы, в частности с классическим вариантом PTC. FOXE1 представляет собой тироид-специфический ДНК-связывающий белок, распознающий сайты связывания на генах тиреоглобулина и тиреопероксидазы, экспрессируемых в фолликулярных клетках щитовидной железы (14, 15). Хотя точная роль FOXE1 в PTC еще не установлена, это исследование предоставляет дополнительные доказательства участия FOXE1 в канцерогенезе щитовидной железы.Rs1867277 до сих пор является единственным функциональным вариантом, связанным со спорадическими PTC, идентифицированными в гене FOXE1 , и аллель риска (A) усиливал транскрипцию FOXE1 за счет создания сайта связывания для факторов транскрипции USF1 и USF2. Тот факт, что более сильные ассоциативные сигналы наблюдались для SNP вне блока C, содержащего FOXE1 , как в исландских, так и в белорусских исследованиях, может указывать на существование последовательностей ДНК в блоке B с неизвестной функцией, действующих совместно с rs1867277.Конечно, однако, мы не можем исключить участие других генов в этом регионе.

    Хотя связь rs3 с PTC была сильнее в случаях с ранним началом, чем в случаях с поздним началом, различие не было статистически значимым ( p -гетерогенность = 0,063). Сообщалось, что короткая латентность часто связана с более агрессивными опухолями с выраженной местной инвазией и отдаленными метастазами (16). Однако напрямую связать наши результаты с такими морфологическими особенностями сложно, поскольку экологический фон пациентов, включая индивидуальную дозу облучения щитовидной железы и подробную клиническую информацию, недоступен.

    Считается, что индивидуальная предрасположенность к раку щитовидной железы является комплексной, включающей взаимодействие генов с низкой пенетрантностью и окружающей среды. Здесь мы представляем первое свидетельство того, что риск развития ПТК после внутреннего радиационного облучения в значительной степени связан с генетической детерминантой, определяющей риск злокачественных новообразований щитовидной железы человека в общей популяции. Тем не менее, FOXE1 вряд ли будет единственным ключевым игроком в связанном с радиацией канцерогенезе щитовидной железы, и еще предстоит установить, имеет ли связанный с радиацией ПТК другие этиологические специфические генетические компоненты наследственной предрасположенности.Rs9 на хромосоме 14q13.3, сильно связанный со спорадическим PTC в исландской популяции, не был значимым в наших результатах. Более того, в нашем исследовании GWA были идентифицированы два дополнительных SNP со значением мета-анализа P , меньшим, чем 1 × 10 −6 , один из которых находился на хромосоме 9p, а другой – на хромосоме 12p. Поскольку ни один из этих хромосомных локусов не был идентифицирован как связанный со спорадическими PTC, они могут быть потенциальными кандидатами в локусы чувствительности, специфичные для связанных с радиацией PTC.Эти наблюдения ясно указывают на то, что различные генетические компоненты участвуют в канцерогенезе спорадических и связанных с облучением ПТК.

    На сегодняшний день опубликовано лишь несколько исследований методом случай-контроль для выявления генетических факторов риска радиационно-связанного рака щитовидной железы. Три исследования включали Чернобыльское ПТК (17–19) и рак щитовидной железы в когорте профессионально облученных людей (20). В недавней статье были изучены генетические детерминанты у пациентов с лучевыми узлами щитовидной железы (21).Возможности связи между риском PTC после радиационного воздействия и TP53 (ID: 7157) (17, 18), RET (ID: 5979) (20) или XRCC1 (ID: 7515) (20) были продемонстрированы. Однако большинство этих исследований имели ограниченный размер выборки и недостаточный охват генов. Помимо того, что полиморфизм TP53 Arg72Pro (rs1042522) связан с риском радиационно-зависимого ПТК у взрослых пациентов (17, 18), результаты не были воспроизведены в независимых наборах образцов.Ни один из маркеров SNP, которые были значимыми в вышеуказанных исследованиях, не входил в набор Illumina. Согласно HAPMAP, rs25487 ( XRCC1 ) и rs1800858 ( RET ) находятся в полном LD ( D ′ = 1, r 2 = 1) с rs1799778 и rs2505535 соответственно, которые находятся на множество. Однако ассоциации были отрицательными для обоих маркеров в нашем исследовании ( P = 0,94 для rs1799778 и P = 0,03 для rs2505535).

    МАТЕРИАЛЫ И МЕТОДЫ

    Исследуемые группы

    Всего 667 пациентов (174 мужчины и 493 женщины, соотношение полов 0.35) с диагнозом «рак щитовидной железы» в 1989–2009 гг. Критерии включения для случаев были следующими: (i) возраст на момент аварии на Чернобыльской АЭС 0–18 лет, в том числе in utero в апреле – июне 1986 года, которые (ii) проживали в то время в радиоактивно загрязненных регионах. Беларуси и (iii) гистологически подтвержденный диагноз PTC. Демографическая и диагностическая информация была получена из Центра рака щитовидной железы (Минск, Беларусь). На момент облучения 378 пациентов были жителями Гомельской области Беларуси, которая является наиболее радиоактивно загрязненной территорией страны, 195 пациентов – из Брестской области, 10 – из Могилевской области и 84 – из других радиоактивно загрязненных регионов страны.

    В качестве контрольных субъектов было набрано 620 здоровых людей (165 мужчин и 455 женщин, соотношение полов 0,36). Критериями включения в контрольную группу были: (i) возраст на момент аварии от 0 до 18 лет, в том числе in utero в апреле – июне 1986 г., которые (ii) проживали в то время в радиоактивно загрязненных регионах Беларуси. , (iii) эутиреоидное состояние и (iv) отсутствие рака щитовидной железы на момент отбора проб (с февраля 2006 г. по апрель 2009 г.). На момент возможного радиационного воздействия 574 здоровых участника были жителями Брестской области, 34 – Гомельской области, 11 – Могилевской области и один человек из другой области.Согласно радиоэкологическим и радиационно-эпидемиологическим исследованиям, считается, что все больные и 620 человек контрольной группы получили дозы на щитовидную железу в диапазоне 21–1500 мГр (22, 23). Дополнительные образцы ДНК 207 человек, которые: (i) родились после 1987 года (79 образцов), (ii) были старше 18 лет на момент аварии (три образца) или (iii) считались подвергшимися незначительному воздействию Количество радиации, если таковая имеется, согласно информации об их проживании (125 образцов), также использовалось для исследований в качестве репрезентативных контрольных групп населения Беларуси.Демографические данные и информация о месте проживания были получены путем личного опроса, а образцы периферической крови были собраны в загрязненных регионах в ходе проводимых два раза в год программ скрининга щитовидной железы (которые также включали УЗИ шеи и консультацию эндокринолога) населения Беларуси. Состояние эутиреоза подтверждено лабораторными тестами и составляет 1,64 ± 1,57 мкЕд / мл для тиреотропина (нормальный диапазон 0,5–5,0 мкЕ / мл) и 1,17 ± 0,28 нг / дл для свободного тироксина (нормальный диапазон 0,7–1,55 нг / дл) во всем контроле. группа.Отсутствие рака щитовидной железы было решено путем отбора только тех людей, у которых не обнаруживались узлы щитовидной железы на УЗИ. Для исследования 2 в качестве контроля популяции использовались генотипы 448 русских контролей (24). Экспертный совет учреждения и комитет по этике каждого учреждения одобрили используемые протоколы. Все участники были полностью проинформированы о целях и процедурах, и было получено письменное согласие.

    Препарат ДНК

    ДНК

    экстрагировали из мононуклеарных клеток периферической крови с использованием набора Puregene (Qiagen, Germantown, MD, USA) согласно протоколу производителя.Концентрацию и чистоту ДНК измеряли на спектрофотометре Nanodrop 1000 (Thermo Scientific, Waltham, MA, USA). До использования образцы хранили при -80 ° C.

    Исследование GWA

    Были выполнены две серии сканирований генома с использованием двух независимых наборов образцов. В первом и втором сканировании генома (исследование 1 и исследование 2) были использованы 194 случая и 179 контролей, а также 214 случаев и 448 контрольных российских популяций. Проверка результатов сканирования генома (исследование 3) была выполнена анализом Taqman с использованием третьего независимого набора образцов, состоящего из 259 случаев и 648 контролей.

    Исследование 1: сканирование генома

    В общей сложности 567 512 аутосомных SNP были генотипированы у 194 пациентов с раком щитовидной железы и 179 контрольных образцов с помощью Illumina Human610-Quad BeadChip на системе генотипирования BeadStation 500G, а также были сгенерированы вызовы генотипов и составлены сводные файлы с использованием программного обеспечения Bead Studio версии 3.1.3.0. пакет (Illumina, Inc., Сан-Диего, Калифорния, США). Процедуры контроля качества систематически выполнялись для результатов сканирования генома. Первоначально из анализа были исключены две контрольные пробы с частотой обращения менее 90%.Впоследствии степень родства между людьми была исследована Пи-хатом в PLINK, методе многомерного масштабирования (25). Для семи пар случаев и пяти пар контролей, показывающих высокую степень родства (PI-HAT> 0,3), была исключена выборка с более низкой частотой встречаемости. Анализ главных компонентов с помощью «smartpca» в EIGENSOFT (26), включая образцы фазы II HAPMAP, подтвердил отсутствие отклонений во всех образцах ДНК из европеоидной популяции. После контроля качества маркеров SNP, в общей сложности 35 488 маркеров были исключены из-за низкой частоты вызовов (менее 95%), низкой частоты минорных аллелей (менее 0.01) или значительное искажение равновесия Харди – Вайнберга (значение P меньше 10 −7 ). После этих шагов 532 024 маркера SNP 187 пациентов с ПТК (средний возраст ± стандартное отклонение: 3,0 ± 3,8 года) и 172 контрольных (1,5 ± 2,8 года) были использованы для статистического анализа.

    Ассоциацию маркеров SNP на Х-хромосоме исследовали в отдельном анализе. Были применены те же критерии для контроля качества, и 16 448 маркеров SNP были использованы для проверки связи заболевания между 58 случаями и 60 контрольными случаями для мужчин и 128 случаями и 111 контрольными случаями для женщин.

    Исследование 2: сканирование генома

    У 214 пациентов с раком щитовидной железы (средний возраст ± стандартное отклонение: 5,8 ± 5,2 года) 567 512 аутосомных SNP были генотипированы с использованием тех же массивов SNP, что и использованные в исследовании 1. Генотипические вызовы 448 российских образцов ДНК были использованы в качестве популяционного контроля. . Для контроля качества применялись те же критерии исключения, что и в исследовании 1, но образцы ДНК не были удалены из анализа. После удаления 57 902 маркеров SNP, соответствующих критериям исключения, для статистического анализа было использовано в общей сложности 509 610 маркеров SNP.Анализ Х-хромосомы был выполнен, как описано для исследования 1, в 52 случаях и 235 контрольных для мужчин и в 161 случае и 213 контрольных для женщин.

    Исследование 3: валидационный анализ

    Проверка результатов сканирования генома была проведена в 259 случаях (средний возраст ± стандартное отклонение: 6,8 ± 5,5 лет) и 648 контрольных случаях (средний возраст ± стандартное отклонение: 6,2 ± 5,9 года) с использованием анализов Taqman SNP (Applied Biosystems, Foster City, CA , США) в соответствии с рекомендациями производителя. Предварительно разработанный и функционально протестированный зонд использовался для rs3 (C_15_20, Applied Biosystems), а специально разработанный зонд того же производителя был использован для rs1867277.

    Статистический анализ

    Связь случай – контроль в каждом исследовании изучали с использованием критерия χ 2 для сравнения генотипических распределений между случаями и контролем (27). Стратификацию популяции оценивали методом геномного контроля (28). Мета-анализ результатов сканирования генома был проведен в режиме тенденций метода Mantel – Haenszel (29) путем объединения генотипов исследования 1 и исследования 2 для 506 840 аутосомных маркеров SNP, прошедших контроль качества в обоих исследованиях.Генотипы аутосомных SNP, полученные в исследованиях 1 и 2, были объединены, и стратификация населения была скорректирована с помощью Eigenstrat (26) с последующим методом геномного контроля. Мета-анализ 16 448 маркеров SNP на Х-хромосоме был проведен для мужчин исследования 1 и мужчин исследования 2, а также для женщин исследования 1 и женщин исследования 2.

    Общий уровень значимости rs3 был рассчитан с помощью метаанализа с использованием метода Mantel – Haenszel, объединив генотипы исследования 1 и исследования 3.Структура LD была получена с использованием генотипов исследования 1 и исследования 2 с использованием программного обеспечения Haploview (30) путем расчета попарных индексов LD ( D ‘и r 2 ) между маркерами SNP в регионе.

    Вменение отсутствующих генотипов выполняли с помощью MACH 1.0 (http://www.sph.umich.edu/csg/abecasis/MaCH/index.html). Данные генотипа CEU (CEPH European), полученные из базы данных HapMap фазы III (draft2), использовали в качестве эталона, а область размером 425 т.п.н. между rs4742698 и rs4618817 исследовали на предмет ассоциации.В процессе вменения было реализовано 50 итераций цепи Маркова.

    ДОПОЛНИТЕЛЬНЫЙ МАТЕРИАЛ

    Дополнительные материалы доступны в HMG онлайн.

    ФИНАНСИРОВАНИЕ

    Эта работа была частично поддержана Глобальной программой COE Университета Нагасаки и «Грантами для молодых ученых» Министерства образования, культуры, спорта, науки и технологий (Япония). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    БЛАГОДАРНОСТИ

    Мы хотели бы поблагодарить всех участников исследования, которые сделали возможным этот проект. Российские контрольные данные взяты из трех исследований: КМСУ: А.В. Полоников, В. Иванов, М.А.Солодилова; ТОМСК: М. Фрейдин, В. Пузырев, Л.М.Огородова; УФА: Е.К. Хуснутдинова, А. Карунас, Ю. Федорова. Мы также благодарим М. Кокубо, М. Паломареса, М. Аксорнворанарта и М. Мизутани за техническую помощь, а также А. Йошизуми, Х. Унеме и К. Хиросаву за управление информатикой.

    Заявление о конфликте интересов . Ничего не объявлено.

    ССЫЛКИ

    1,,.

    Рак щитовидной железы после Чернобыля

    ,

    Nature

    ,

    1992

    , т.

    359

    стр.

    21

    2,,. ,

    Отчет экспертной группы Чернобыльского форума ООН «Здоровье»

    ,

    2006

    Женева

    WHO Press

    3,,,,,,,,, et al.

    Риск рака щитовидной железы после воздействия 131I в детстве

    ,

    J.Natl Cancer Inst.

    ,

    2005

    , т.

    97

    (стр.

    724

    732

    ) 4,,,,,,,,, и др.

    Когортное исследование рака щитовидной железы и других заболеваний щитовидной железы после чернобыльской аварии: рак щитовидной железы в Украине выявлен при первом обследовании

    ,

    J. Natl Cancer Inst.

    ,

    2006

    , т.

    98

    (стр.

    897

    903

    ) 5.

    Рак после ядерных осадков: уроки аварии на Чернобыльской АЭС

    ,

    Нац.Rev. Cancer

    ,

    2002

    , vol.

    2

    (стр.

    543

    549

    ) 6,,,,,,,,, и др.

    Аутоиммунный тиреоидит и воздействие йода 131 в украинском когортном исследовании рака щитовидной железы и других заболеваний щитовидной железы после Чернобыльской аварии: результаты первого цикла скрининга (1998–2000 гг.)

    ,

    J. Clin. Эндокринол. Метаб.

    ,

    2006

    , т.

    91

    (стр.

    4344

    4351

    ) 7,,,,,,,,.

    Рак щитовидной железы после воздействия внешнего излучения: объединенный анализ семи исследований

    ,

    Radiat. Res.

    ,

    1995

    , т.

    141

    (стр.

    259

    277

    ) 8,,,,,,,,, и др.

    Постчернобыльская карцинома щитовидной железы у детей и подростков Беларуси: сравнение с природной карциномой щитовидной железы в Италии и Франции

    ,

    J. Clin. Эндокринол. Метаб.

    ,

    1997

    , т.

    82

    (стр.

    3563

    3569

    ) 9,,,,,,,,, и др.

    Рак щитовидной железы у украинцев и белорусов, которые были детьми или подростками во время аварии на Чернобыльской АЭС

    ,

    J. Radiol. Prot.

    ,

    2006

    , т.

    26

    (стр.

    51

    67

    ) 10,,,,,.

    Индивидуальные дозы облучения щитовидной железы на основе анкетирования и измерений в Украине в результате аварии на Чернобыльском ядерном реакторе

    ,

    Радиат. Res.

    ,

    2006

    , т.

    166

    (стр.

    271

    286

    ) 11,,,,,,,,, и др.

    Распространенные варианты 9q22.33 и 14q13.3 предрасполагают к раку щитовидной железы в европейских популяциях

    ,

    Nat. Genet.

    ,

    2009

    , т.

    41

    (стр.

    460

    464

    ) 12,,,,,,,,, и др.

    Вариант rs1867277 в гене FOXE1 придает предрасположенность к раку щитовидной железы за счет привлечения факторов транскрипции USF1 / USF2

    ,

    PLoS Genet.

    ,

    2009

    , т.

    5

    стр.

    e1000637

    13

    НКДАР ООН

    In

    ,

    Научный комитет Организации Объединенных Наций по действию атомной радиации, Отчет Генеральной Ассамблее 1994 г.

    ,

    1994

    Нью-Йорк

    14,,,,,,,,,.

    TTF-2, новый белок вилкообразной формы, демонстрирует временную экспрессию в развивающейся щитовидной железе, которая согласуется с ролью в контроле начала дифференцировки

    ,

    EMBO J.

    ,

    1997

    , т.

    16

    (стр.

    3185

    3197

    ) 15,,.

    FKHL15, новый человеческий представитель семейства генов вилки, расположенный на хромосоме 9q22

    ,

    Genomics

    ,

    1997

    , vol.

    41

    (стр.

    390

    396

    ) 16,,,,,,,,, и др.

    Карцинома щитовидной железы после чернобыльского латентного периода, морфология и агрессивность

    ,

    руб. J. Cancer

    ,

    2004

    , т.

    90

    (стр.

    2219

    2224

    ) 17,,,,,,,,, и др.

    Полиморфизм кодона 72 TP53 при радиационно-ассоциированном папиллярном раке щитовидной железы человека

    ,

    Oncol. Реп.

    ,

    2006

    , т.

    15

    (стр.

    949

    956

    ) 18,,,,,,,,.

    Полиморфизм генов ответа на повреждение ДНК при радиационно-связанной и спорадической папиллярной карциноме щитовидной железы

    ,

    Endocr. Relat. Рак

    ,

    2009

    , т.

    16

    (стр.

    491

    503

    ) 19,,,,,,,.

    Исследование потери гетерозиготности и частот SNP в гене RET при папиллярной карциноме щитовидной железы

    ,

    Thyroid

    ,

    2005

    , vol.

    15

    (стр.

    100

    104

    ) 20,,,,,,.

    Папиллярный рак щитовидной железы и полиморфные варианты генов, связанных с TSHR и RET: вложенное исследование случай-контроль в группе американских радиологических технологов

    ,

    Cancer Epidemiol.Биомаркеры Пред.

    ,

    2007

    , т.

    16

    (стр.

    174

    177

    ) 21,,,,,,,, и др.

    Узлы щитовидной железы, полиморфные варианты репарации ДНК и генов, связанных с RET, и взаимодействие с воздействием ионизирующего излучения в результате ядерных испытаний в Казахстане

    ,

    Radiat. Res.

    ,

    2009

    , т.

    171

    (стр.

    77

    88

    ) 22,,.

    Радиоэкологическая модель для реконструкции доз облучения щитовидной железы населения Беларуси после аварии на Чернобыльской АЭС

    ,

    Радиат.Environ. Биофиз.

    ,

    2004

    , т.

    43

    (стр.

    101

    110

    ) 23,,,,,.

    Дозиметрия радиации для сильно загрязненного населения Беларуси, России и Украины, а также для менее загрязненного населения в Европе

    ,

    Health Phys.

    ,

    2007

    , т.

    93

    (стр.

    487

    501

    ) 24,,,,,,,,, и др.

    Исследование тонкой структуры европейского населения с приложениями к исследованиям ассоциаций болезней

    ,

    Eur.J. Hum. Genet.

    ,

    2008

    , т.

    16

    (стр.

    1413

    1429

    ) 25,,,,,,,, и др.

    PLINK: набор инструментов для полногеномной ассоциации и популяционного анализа сцепления

    ,

    Am. J. Hum. Genet.

    ,

    2007

    , т.

    81

    (стр.

    559

    575

    ) 26,,,,,.

    Анализ основных компонентов корректирует стратификацию в полногеномных ассоциативных исследованиях

    ,

    Nat.Genet.

    ,

    2006

    , т.

    38

    (стр.

    904

    909

    ) 27,.

    Тест тенденции оптимального режима доза-эффект для таблиц генотипов SNP

    ,

    Genet. Эпидемиол.

    ,

    2009

    , т.

    33

    (стр.

    114

    127

    ) 28,.

    Геномный контроль для ассоциативных исследований

    ,

    Biometrics

    ,

    1999

    , vol.

    55

    (стр.

    997

    1004

    ) 29,.

    Статистика Mantel – Haenszel и прямая стандартизация

    ,

    Stat.Med.

    ,

    1982

    , т.

    1

    (стр.

    37

    39

    ) 30,,,.

    Haploview: анализ и визуализация карт LD и гаплотипов

    ,

    Bioinformatics

    ,

    2005

    , vol.

    21

    (стр.

    263

    265

    )

    Заметки автора

    © Автор, 2010. Опубликовано Oxford University Press. Все права защищены. Для получения разрешений, пожалуйста, напишите: журналы[email protected]

    Д-р Лариса Гескин, д.м.н. | Нью-Йорк, штат Нью-Йорк | Дерматолог

    Могамулизумаб в сравнении с вориностатом при ранее леченной кожной Т-клеточной лимфоме (MAVORIC): международное открытое, рандомизированное, контролируемое исследование фазы 3

    Любомир Сокол, Лариса Дж. Гескин, Крейг Элметс, Джон Грир, Ким Дж. Герберт Эрадат, Эми Мусиек, Барбара Про, Ален Х Рук, Пьерлуиджи Порку, Дэвид С. Фишер, Андрей Шустов, Мадлен Дювич, Брайан Полигон

    Антибиотики и имиквимод для лечения кожной Т-клеточной лимфомы у ветеранов: популяция пациентов с воздействием апельсинового агента

    Кристина А Дель Гуццо, Арсений Кожадинович, Рави Виннакота, Лариса Дж.Гескин, Дж. Ньюман, Эрик Лангхофф, Юн-Хи А. Парк, Сьюзан Э. Бейтс, Али Н. Дана

    Транскриптомный анализ выявляет различия в экспрессии генов актинического кератоза после лечения имиквимодом и между респондентами и не отвечающими

    Меган Х. Трагер, Эмануэль М. Ризк, Шэрон Роуз, Куикси Чжу, Бранден Лау, Бенджамин Т. Фуллертон, Джая Сарин Прадхан, Майкл Мур, Аюш С. Шривастава, Жизель Сингер, Робин Д. Гартрелл, Руи Чанг, Лариса Дж. Гескин , Yvonne M. Saenger, Gary Goldenberg

    Актинический хейлит: систематический обзор вариантов лечения

    Megan H.Трагер, К. Фармер, Клаас Ульрих, Николь Бассет-Сеген, Ф. Хермс, Лариса Дж. Гескин, Жан-Давид Буазиз, Селеста Леббе, А. де Массон, Мартин Баго, Г. Добос

    Исследование PROVe: US Real -Мировой опыт использования геля хлорметина / мехлорэтамина в сочетании с другими методами лечения пациентов с кожной Т-клеточной лимфомой Mycosis Fungoides.

    Эллен Дж. Ким, Джоан Гитарт, Кристиан Кверфельд, Майкл Жирарди, Эми Мусиек, Олег Э. Акилов, Джеймс Т. Энджелло, Уильям Л. Бейли, Лариса Дж.Гескин

    Следует ли визуализировать лимфатические узлы при первоначальной диагностике грибовидного микоза на ранней стадии? Результаты международного исследования PROspective Skin Lymphoma International Prognostic Index (PROCLIPI) Ортис-Ромеро, Рудольф Стадлер, Роберт Ноблер, Эммануэла Генова, Тереза ​​Эстрах, Айкатерини Пацаци, Яэль Анне Лешем, Х. Прага-Навех, Эмилио Берти, Сильвия Альберти-Виолетти, Ричард Коуэн, Констанца Йонак, В.Николау, Кристина Миттелдорф, О. Акилов, Лариса Дж. Гескин, Рубета Н. Матен, Мари Бейло-Барри, Лийса Вакева, Хосе Антонио Санчес, Октавио Сервитье, Марион Вобсер, Дж. Ю, М. Бейн, Эндрю Бейтс, Г. Даннил , Марта Маршалко, AM Buschots, Ulrike Wehkamp, ​​F. Evison, E. Hong, Iris Amitay-Laish, René Stranzenbach, Maarten H. Vermeer, Rein Willemze, Werner Kempf, Lorenzo Cerroni, Sean Whittaker, Youn H. Kim, Julia Scarisbrick

    Automated Digital TIL анализ (ADTA) добавляет прогностическую ценность стандартной оценке глубины и изъязвления при первичной меланоме.

    Майкл Мур, Изабель Д. Фриснер, Эмануэль М. Ризк, Бенджамин Т. Фуллертон, Манас Мондал, Меган Х. Трагер, Карен Мендельсон, Иджеуру Чикека, Тахсин Курк, Раджарси Гупта, Бетани Р. Рор, Эрик Дж. Робинсон, Балаш Ас, Руи Чанг, Харриет М. Клюгер, Брет Табак, Лариса Дж. Гескин, Бэзил А. Хорст, Кевин Гарднер, Джордж В. Нидт, Джулида Т. Селеби, Робин Д. Гартрелл-Коррадо, Джейн Л. Мессина, Тэмми Ферринджер, Дэвид Л. Римм, Джоэл Х. Сальц, Цзин Ван, Рами Вангури, Ивонн М. Сенгер

    Кожные находки у госпитализированных и тяжелобольных пациентов с COVID-19: серия случаев из 15 пациентов.

    Марк А. Стром, Меган Х. Трагер, Дмитрий Тимерман, Александра Дж. Коромилас, Кэти Беррис, Дональд В. Белсито, Ариэль Эбер, Софи А. Гринберг, Самира Хусейн, Джесси М. Левин, Флудиона Нака, Кристина К. Патрон, Аарон Кулон, Челси Купер, Фредерик Б. Бартоломью, Мелисса Бек, Маргарет Л. Дауд, Кортни Э. Энслин, Стефани М. Галлитано, Эрик Леш, Дана Маладжян, Лаура Мелник, Джордж В. Нидт, Лаура Н. Увакве, Ха Линь Ву, Роберт Р. Вальтер, Фарамарц Х. Сами, Лариса Дж. Гескин

    Эффект качества жизни моноклонального антитела против CCR4 Могамулизумаб по сравнению с вориностатом у пациентов с Т-клеточной лимфомой кожи.

    Пьерлуиджи Порку, Стейси Хадженс, Стивен М. Хорвиц, Пьетро Куаглино, Ричард А Коуэн, Лариса Гескин, Мари Бейло-Барри, Лисбет Флоден, Мартин Багот, Атанасиос Цианакас, Элисон Дж. Московиц, Аурис Хуэно, Бриджит Дрфане , Долорес Кабальеро, Молли Леони, Стивен Дейл, Фиона Херр, Мадлен Дувик

    Оценка схем лечения гелем хлорметин / мехлорэтамин у пациентов с грибковым микозом стадий I-IIA: своевременный повторный анализ рандомизированного контролируемого исследования фазы 2.

    Лариса Дж. Гескин, Эллен Дж. Ким, Джеймс Т. Анджелло, Юн Х. Ким

    Отсутствие системной абсорбции геля мехлорэтамина для местного применения у пациентов с кожной Т-клеточной лимфомой грибкового микоза.

    Christiane Querfeld, Larisa J. Geskin, Ellen J. Kim, Julia Scarisbrick, Pietro Quaglino, Evangelia Papadavid, James T. Angello, Pablo L. Ortiz-Romero

    История болезни папиллярной цифровой аденокарциномы и мутации Quaglino с мутацией BRAFV600E Груз.

    Меган Х.Трагер, Магдалена Юркевич, Шахир Хан, Джордж В. Нидт, Лариса Дж. Гескин, Ричард Д. Карвахал

    Обзор вскрытия: «COVID Toes».

    Mine M Yilmaz, Matthias J Szabolcs, Larisa J. Geskin, George W. Niedt

    Полногеномный анализ транскриптома STAT6-регулируемых генов в кожной Т-клеточной лимфоме на поздней стадии

    Alyxzandria M Gaydosik, Dawn Queen, Меган Х. Трагер, Олег Э. Акилов, Лариса Дж. Гескин, Патриция Фушиотти

    Течение грибкового микоза под действием блокаторов цитокинового пути: многоцентровый анализ реальных клинических данных.

    Ирис Амитай-Лаиш, Эммануэла Генова, Пабло Л. Ортис-Ромеро, Кристина Вико ‐ Алонсо, Сима Розати, Лариса Дж. Гескин, Василики Николау, Евангелия Пападавид, Авив Барзилай, Лев Павловский, Елена Дидковски, Хадас Олег Прагг Нав. Э. Акилов, Эммилия Ходак

    Гены УФ-биомаркеров для классификации и стратификации риска кожных актинических кератозов и подтипов плоскоклеточного рака.

    Королева рассвета, Яо Шен, Меган Х. Трагер, Адриана Лопес, Фарамарц Х. Сами, Джесси М.Левин, Джордж В. Нидт, Лариса Дж. Гескин, Лян Лю

    Красная волчанка, имитирующая первичную В-клеточную лимфому в краевой зоне кожи.

    Меган Х. Трагер, Кэролайн Рам-Вольф, Жан-Давид Буазиз, Максим Баттистелла, Мари-Доминик Виньон-Пеннамен, Жаклин Риве, Полин Брис, Адель де Массон, Лариса Дж. Гескин, Мартин Баго, Г. Добос

    Отличие меланофагов от опухоли у пациентов с меланомой, получавших талимоген лахерпарепвек.

    Клэр Одри-Баян, Меган Х.Трагер, Робин Д. Гартрелл-Коррадо, Эмануэль М. Ризк, Джая Сарин Прадхан, Эндрю М. Сильверман, Адриана Лопес, Дуглас К. Маркс, Джордж В. Нидт, Лариса Дж. Гескин, Ивонн М. Сенгер

    США Кожное покрытие Рекомендации Консорциума лимфомы по лечению кожных лимфом во время пандемии COVID-19.

    Джон А. Зич, Вейюн З. Ай, Олег Э. Акилов, Джой Б. Картер, Мадлен Дювич, Франсин М. Фосс, Майкл Жирарди, Алехандро А. Гру, Эллен Ким, Эми Мусиек, Элиза А. Олсен, Стефан М.Шике, Мичи М. Шинохара, Жасмин Заин, Лариса Дж. Гескин

    Ретикулярная кожная сыпь как начальный признак коронавирусной инфекции 2019

    Марк А. Стром, Меган Х. Трэгер, Лариса Дж. Гескин

    Коллизионный вариант CD8 + грибовидный микоз и вялотекущая лимфоидная пролиферация CD8 +

    Адриана Т. Лопес, Меган Х. Трагер, Синтия М. Магро, Лариса Дж. Гескин

    Мутации NPM1 и FLT3-TKD обнаруживаются у пациентов с кутисным лейкозом

    Теодора Конь Ротемберг, Лариса Дж.Geskin, Joseph G Jurcic, George Niedt MDAuthors

    Качество жизни пациентов с рецидивирующей / рефрактерной кожной Т-клеточной лимфомой: результаты рандомизированного исследования III фазы ALCANZA.

    Рейнхард Даммер, Генри Майлз Принс, Шон Уиттакер, Стивен М. Хорвиц, Юн Х. Ким, Джулия Скарисбрик, Пьетро Куаглино, Пьер Луиджи Зинзани, Паскаль Вольтер, Герберт Эрадат, Лорен К. Пинтер-Браун, Хосе Антонио Санчес, Пабло Л. Ортис-Ромеро, Олег Э. Акилов, Лариса Дж. Гескин, Аурис Хуэн, Ян Валевски, Инхуэй Ван, Джули Лисано, Акшара Ричхария, Джозеф Фелисиано, Янян Чжу, Вероника Банн, Мередит Литтл, Эрин Загадаилов, Мехул Далал, Мадлен Duvic

    Перспективы рекомендаций по лечению рака кожи во время пандемии COVID-19.

    Лариса Дж. Гескин, Меган Х. Трейджер, Сумаира З. Ааси, Дэвид Р. Бикерс, Ричард Д. Карвахал, Пол Нгием, Брет Табак, Натали К. Зейтуни, Фарамарц Х. Сами

    Биомаркеры меланомы и других заболеваний. профилактика рака кожи меланомы и стратификация риска.

    Меган Х. Трагер, Лариса Дж. Гескин, Фарамарц Х. Сами, Лян Лю

    Комбинированная блокада контрольных точек при метастатических кожных злокачественных новообразованиях у реципиентов трансплантата почки.

    Меган Х. Трейджер, Шана М.Коли, Джеффри К. Дьюб, Шахир Хан, Мэтью Ингхэм, Фарамарц Х. Сами, Лариса Дж. Гескин, Диана МакДоннелл, Дэниел Броудер, Ивонн М. Сенгер, Ричард Д. Карвахал

    FLT-PET на 6 недель прогнозируемого ответа, оцененного КТ через 12 недель у пациентов с меланомой, получавших пембролизумаб.

    Рэнди Йе, Меган Х. Трагер, Эмануэль М. Ризк, Грейс Г. Финкель, Люк В. Баркер, Ричард Д. Карвахал, Лариса Дж. Гескин, Гэри К. Шварц, Лоуренс Х. Шварц, Лоран Деркль, Ивонн М. Saenger

    Достижения в профилактике и надзоре за кожными злокачественными новообразованиями.

    Меган Х. Трейджер, Королева рассвета, Фарамарз Х. Сами, Ричард Д. Карвахал, Дэвид Р. Бикерс, Лариса Дж. Гескин

    Демодекс-индуцированный фолликулярный муциноз головы и шеи, имитирующий фолликулотропный грибовидный микоз

    Меган Х. Trager, Dawn Queen, Diane Chen, Emmilia Hodak, Larisa J. Geskin

    Онколитические вирусы для лечения метастатической меланомы

    Megan H. Trager, Larisa J. Geskin, Yvonne M. Saenger

    Глубокое обучение на основе стандартных изображений H&E первичных опухолей меланомы выявляет пациентов с риском висцерального рецидива и смерти.

    Пратамеш М. Кулкарни, Эрик Робинсон, Джая Сарин Прадхан, Робин Д. Гартрелл-Коррадо, Бетани Р. Рор, Меган Х. Трагер, Лариса Дж. Гескин, Гарриет М. Клюгер, Пок Фай Вонг, Балаш Акс, Эмануэль М. Ризк, Чен Ян, Манас Мондал, Майкл Мур, Иман Осман, Роберт Г. Фелпс, Бэзил А. Хорст, Чжэ Чен, Тэмми Ферринджер, Дэвид Л. Римм, Цзин Ван, Ивонн М. Сенгер

    Низкая экспрессия SATB1 способствует развитию IL -5 и IL-9 при синдроме Сезари

    Альберто Эррера, Саймон Фредхольм, Энтони Ченг, Элени П.Мимиту, Анджелина Сеффенс, Михал Бар-Натан, Эми Сан, Джо-Анн Латковски, Андреас Виллерслев-Олсен, Теркильд Б. Буус, Мария Глууд, Торбьорн Крейсгаард, Сара Торрес-Русилло, Шарлотта М. Бонефельд, Андерс Вутманн, Карстен Гейс Лариса Дж. Гескин, Чжэнцин Оуян, Питер Смиберт, Нильс Эдум, Сергей Б. Коралов

    Воспаление, вызванное азотно-горчичным гелем, вызывает лимфоматоидный папулез у пациентов с грибовидным микозом

    Меган Х. Трагер, Синтия Чен, Лариса Х.Geskin

    Реальный опыт применения геля мехлорэтамина у пациентов с грибовидным микозом и кожной лимфомой: предварительные результаты проспективного обсервационного исследования.

    Эллен Дж. Ким, Лариса Дж. Гескин, Джоан Гитарт, Кристиан Кверфельд, Майкл Жирарди, Эми Мусик, Дэвид Р. Минк, Майкл Дж. Уильямс, Джеймс Т. Анджело, Уильям Л. Бейли

    Биомаркеры, позволяющие прогнозировать выживание и выживаемость. Ответ на ингибиторы иммунных контрольных точек при меланоме.

    Эмануэль М. Ризк, Анджелина Сеффенс, Меган Х.Трейджер, Майкл Мур, Лариса Дж. Гескин, Робин Д. Гартрелл-Коррадо, Уинстон Вонг, Ивонн М. Сенгер

    Кожно-ассоциированный золотистый стафилококк способствует прогрессированию заболевания в CTCL

    Лариса Дж. Гескин

    Текущее состояние ингибиторов гистоновых деацетилов кожная Т-клеточная лимфома.

    Меган Х. Трагер, Лариса Дж. Гескин

    Нарушение регуляции STAT3 в зрелых Т- и NK-клеточных лимфомах.

    Анджелина Сеффенс, Альберто Эррера, Космин А. Тегла, Теркилд Б.Буус, Кеннет Б. Хаймс, Нильс Одум, Лариса Дж. Гескин, Сергей Б. Коралов

    Исправление: Джетер Дж. М., Боулз Т. Л., Куриэль-Левандровски С. и др. Химиопрофилактика меланомы: путь к третьей фазе клинических испытаний. Рак. 2019: 125: 18-44.

    Джоан М. Джетер, Тонья Л. Боулз, Клара Куриэль-Левандровски, Сьюзен М. Светтер, Фабиан В. Филипп, Зальфа А. Абдель-Малек, Лариса Дж. Гескин, Джерри Д. Брюер, Джек Л. Арбайзер, Джеффри Э. Гершенвальд, Эмили Ю. Чу, Джон М. Кирквуд, Нил Ф. Бокс, Полин Фанчейн, Дэвид Э.Фишер, Кари Кендра, Ашфак А. Маргуб, Сьюфи К. Чен, Майкл Э. Мин, Марк Р. Альбертини, Джон Т. Ветто, Ким Марголин, Шерри Л. Пагото, Дженнифер Л. Хэй, Дуглас Гроссман, Даррел Л. Эллис , Мохаммед Кашани-Сабет, Аарон Р. Мангольд, Светомир Н. Маркович, Мейскенс Франк Л. мл., Келли С. Нельсон, Дженнифер Г. Пауэрс, Джун К. Робинсон, Дебджани Сахни, Александар Секулич, Вернон К. Сондак, Мария Л. Вэй, Джонатан С. Загер, Роберт П. Деллавалле, Джон А. Томпсон, Мартин А. Вайншток, Санси А. Личман, Памела Б.Кэссиди

    Международный регистр ранних стадий грибкового микоза PROCLIPI выявляет значительную задержку диагностики у большинства пациентов

    Дж. Скарисбрик, П. Куаглино, Генри Майлз Принс, Евангелия Пападавид, Эмилия Ходак, М. Багот, О. Сервитье, Эмилио Берти , П. Ортис-Ромеро, Р. Стадлер, Айкатерини Пацаци, Р. Ноблер, Эммануэла Генова, Ф. Чайлд, С. Уиттакер, В. Николау, К. Томасини, И. Амитай, Х. Праг Навех, К. Рам- Вольф, Мариса Баттистелла, С. Альберти ‐ Виолетти, Р. Странценбах, В.Гаргалло, К. Муньеса, Триантафилия Колца, Констанце Йонак, С. Поркерт, К. Миттелдорф, Т. Эстрах, А. Комбалия, М. Маршалко, Дж. Цомор, А. Сепези, А. Коццио, Рейнхард Даммер, Н. Пимпинелли , В. Гранди, М. Бейлот-Барри, А. Фам-Ледард, М. Вобсер, Э. Гейссинджер, У. Векамп, М. Вейхенталь, Р. Коуэн, Э. Парри, Дж. Харрис, Р. Ваксмут, Дебора Тернер, Эндрю Бейтс, Юджин Хили, Ф. Траутингер, Дж. Латцка, Дж. Ю, Б. Видианат, Р. Амель-Кашипаз, Л. Маринос, А. Ойкономиди, А. Стратигос, Мари Доминик Виньон-Пеннамен, Ф.Климент, Э. Гонсалес-Барка, Элисавет Георгиу, Р. Сенетта, Пьер Луиджи Зинзани, Л. Вакева, Аннамари Ранки, А.-М. Busschots, E. Hauben, A. Bervoets, F.J.S.H. Woei ‐ A ‐ Jin, Rubeta N Matin, Graham P. Collins, J. Frew, Mike Bayne, G. Dunnill, Pamela McKay, Arvind Arumainathan, R. Azurdia, Kim Benstead, Robert Twigger, Kerri E. Rieger, Ryanne A. Браун, Хосе Антонио Санчес, Денис Мияширо, О. Акилов, С. Макканн, Хелька Сахи, Фабиана М. Дамаско, К. Кверфельд, А. Фолкес, К. Бур, К.-Д. Клемке, П. А. Энц, Рамон М.Pujol, K. Quint, Larisa J. Geskin, E. Hong, F. Evison, Maarten H. Vermeer, Lorenzo Cerroni, W. Kempf, Youn H. Kim, R. Willemze

    Одноклеточная гетерогенность лимфоцитов при распространенной кожной T -Клеточная лимфома опухоли кожи

    Alyxzandria M Gaydosik, Tracy Tabib, Larisa J. Geskin, Claire-Audrey Y Bayan, James F. Conway, Robert Lafyatis, Patrizia Fuschiotti

    Необычная причина двустороннего отека орбиты: иммуноглобулин G4-связанный заболевание, возникающее у больного язвенным колитом.

    Королева рассвета, Амин А. Хедаят, Синтия М. Магро, Лариса Дж. Гескин

    Результаты лечения иммунных кожных побочных эффектов

    Грегори С. Филлипс, Дженнифер Ву, Мэтью Д. Хеллманн, Майкл А. Постоу, Найер А. Ризви, Азаэль Фрейтес-Мартинес, Дональд Чан, Стивен В. Дуза, Роберт Дж. Моцер, Джонатан Э. Розенберг, Маргарет К. Каллахан, Пол Б. Чепмен, Лариса Дж. Гескин, Адриана Т. Лопес, Ванесса А. Рид, Габриэлла Фабброчини, Мария Кармела Аннунциата, Олувасеун Кукойи, Алия Пабани, Чи-Сун Ян, Вен-Хунг Чунг, Алина Маркова, Марио Э.Lacouture

    Нарушение регуляции пути TOX-RUNX3 при кожной Т-клеточной лимфоме.

    Dulmage, BO, Akilov, O., Vu, JR, Falo, LD, Geskin, LJ

    Мультифокальная плеоморфная кожная саркома и роль воспаления и иммуносупрессии у пациента после трансплантации легкого: история болезни

    Мэри Э. Андерсон , Неманья Родич, Антонио Субтиль, Королева Рассвета, Селим М. Аркасой, Джордж В. Нидт, Питер Хилд, Лариса Дж. Гескин

    Паранеопластическая мозжечковая атаксия в клеточной карциноме Меркеля неизвестного первичного происхождения.

    Королева рассвета, Юхан Гу, Адриана Т. Лопес, Дайан Чен, Лариса Дж. Гескин

    Изменения ногтей при синдроме Сезари: одноцентровое исследование и обзор литературы.

    Фабиана М. Дамаско, Лариса Дж. Гескин, Олег Э. Акилов

    Использование синергетического потенциала биологически направленных терапий при кожной Т-клеточной лимфоме.

    Кристина Чанг Патроне, Лариса Дж. Гескин

    Исправление: Глобальные модели лечения грибовидного микоза на поздней стадии / синдром Сезари: многоцентровое ретроспективное последующее исследование, проведенное Международным консорциумом кожной лимфомы (Annals of Oncology (2017) 28 (2517) -2525) DOI: 10.1093 / annonc / mdx352)

    Пьетро Куаглино, Милена Мауле, Его Величество Принц, Пьерлуиджи Порку, С. Хорвиц, М. Дювич, Р. Талпур, М. Вермеер, М. Багот, Джоан Гитарт, Э. Пападавид, Дж. А. Санчес, Э. Ходак, М. Сугайя, Эмилио Берти, П. Ортис-Ромеро, Н. Пимпинелли, О. Сервитье, Алессандро Пилери, Пьер Луиджи Зинзани, Т. Эстрах, Р. Ноблер, Р. Стадлер, MT Фиерро, С. Альберти Виолетти, И. Амитай-Лаиш, К. Антониу, Кьяра Аструа, С. Чаганти, Ф. Чайлд, А. Комбалиа, С. Фаббро, Паоло Фава, В. Гранди, К. Йонак, Э.Мартинес-Эскала, М. Хетерпал, Э.Дж. Ким, К. Маккормак, Т. Миягаки, Денис Мияширо, С. Моррис, К. Муньеса, В. Николау, Г. Огнибене, Ф. Онида, С. Оселла-Абате, С. Поркерт, К. Постиго-Льоренте, К. Рам-Вольф, Симоне Риберо, К. Роджерс, Мартина Санлоренцо, Р. Странценбах, Н. Спаккарелли, А. Стивенс, Даниэла Зугна, А. Х. Ладья, Л. Дж. Гескин, Р. Виллемзе, С. Уиттакер, Р. Хоппе, Дж. Скарисбрик, Ю. Ким

    Основные факты о кожной Т-клеточной лимфоме на 60-м ежегодном собрании Американского общества гематологов: взгляд дерматолога.

    Лариса Дж. Гескин

    Обзор первичных кожных CD30 + лимфопролиферативных заболеваний.

    Синтия Чен, Юхан Д. Гу, Лариса Дж. Гескин

    Паранеопластическая склеродермия на фоне трансформации больших клеток CD30 + грибовидного микоза.

    Королева рассвета, Адриана Т. Лопес, Лариса Дж. Гескин

    Буллезный пемфигоид, связанный с иммунотерапией с новым комбинированным ингибитором контрольных точек

    Наталья М. Фонтесилла, Триша Ханна, Клэр-Одри Ю.Баян, Нина А. Антонова, Лариса Дж. Гескин

    Химиопрофилактика меланомы: путь к третьей фазе клинических испытаний.

    Джоанн М. Джетер, Тонья Л. Боулз, Клара Куриэль-Левандровски, Сьюзан М. Светтер, Фабиан В. Филипп, Зальфа А. Абдель-Малек, Лариса Дж. Гескин, Джерри Д. Брюер, Джек Л. Арбайзер, Джеффри Э. Гершенвальд, Эмили Ю. Чу, Джон М. Кирквуд, Нил Ф. Бокс, Полин Фанчейн, Дэвид Э. Фишер, Кари Кендра, Ашфак А. Маргуб, Суэфи К. Чен, Майкл Э. Мин, Марк Р. Альбертини, Джон Т.Ветто, Ким Марголин, Шерри Л. Пагото, Дженнифер Л. Хэй, Дуглас Гроссман, Даррел Л. Эллис, Мохаммед Кашани-Сабет, Аарон Р. Мангольд, Светомир Н. Маркович, Келли К. Нельсон, Дженнифер Г. Пауэрс, Джун К. . Робинсон, Дебджани Сахни, Александр Секулич, Вернон К. Сондак, Мария Л. Вей, Джонатан С. Загер, Роберт П. Деллавалле, Джон А. Томпсон, Мартин А. Вайнсток, Санси А. Личман, Памела Б. Кэссиди

    Поправка к: Роль онколитических вирусов в лечении меланомы

    Claire-Audrey Y.Баян, Адриана Т. Лопес, Робин Д. Гартрелл, Кимберли М. Комацубара, Маргарет Богардус, Ниша Рао, Синтия Чен, Томас Д. Харт, Томас Энзлер, Эмануэль М. Ризк, Джая Сарин Прадхан, Дуглас К. Маркс, Лариса Дж. Geskin, Yvonne M. Saenger

    Диссеминированные бородавки, ассоциированные с устекинумабом.

    Мэри Э. Андерсон, Королева Рассвета, Стивен Л. Вэнс, Лариса Дж. Гескин

    Успешное лечение лекарственной реакции с эозинофилией и рецидива синдрома системных симптомов пероральным импульсным дексаметазоном.

    Клэр-Одри И. Баян, Адриана Т. Лопес, Наталья М. Фонтесилла, Лариса Дж. Гескин

    Случай буллезного пемфигоида, вызванного ниволумабом: обзор дерматологической токсичности, связанной с белком запрограммированной клеточной смерти-1 / лигандом запрограммированной смерти -1 Ингибиторы и рекомендации по диагностике и лечению

    Адриана Т. Лопес, Лариса Дж. Гескин

    Текущее состояние ингибиторов HDAC при кожной Т-клеточной лимфоме

    Адриана Т. Лопес, Сьюзан Э. Бейтс, Лариса Дж.Гескин

    Роль онколитических вирусов в лечении меланомы

    Клэр-Одри Ю. Баян, Адриана Т. Лопес, Робин Д. Гартрелл, Кимберли М. Комацубара, Маргарет Богардус, Ниша Рао, Синтия Чен, Томас Д Харт, Томас Энцлер, Эмануэль М. Ризк, Джая Сарин Прадхан, Дуглас К. Маркс, Лариса Дж. Гескин, Ивонн М. Сенгер

    Ингибитор протеина-1 программируемой гибели клеток, индуцированная кольцевидной гранулемой и гипертрофическим красным плоским лишаем, маскирующимся под плоскоклеточный рак.

    Наталья М.Fontecilla, Николь В. Киттлер, Адриана Т. Лопес, Кристин Янг, Лариса Дж. Гескин

    Интегрированный ресурс данных для геномного анализа кожной Т-клеточной лимфомы.

    Ли-Вей Чанг, Кристина С. Патроне, Вей Ян, Ракель Рабионет, Фернандо Галлардо, Бланка Эспине, Мукеш К. Шарма, Майкл Жирарди, Корнелис П. Тенсен, Маартен Х. Вермеер, Лариса Дж. Гескин

    Стоимость исследования -анализ эффективности системного лечения кожной Т-клеточной лимфомы.

    Лариса Ю.Гескин, Дэниел К. Мэлоун

    Анемический невус: остров защиты в условиях лекарственной гиперчувствительности

    Адриана Т. Лопес, Вероника Ротемберг, Самира Хусейн, Пол Шнайдерман, Лариса Дж. Гескин

    Ониходистрофия при синдроме Сезари.

    Фабиана М. Дамаско, Лариса Дж. Гескин, Олег Е. Акилов

    Три метода загрузки антигена в вакцинах на дендритные клетки от метастатической меланомы.

    Лариса Дж. Гескин, Джеймс Дж. Дамиано, Кристина С. Патроне, Лиза Х.Баттерфилд, Джон М. Кирквуд, Луи Д. Фало

    Обзор буллезного пемфигоида, связанного с ингибиторами PD-1 и PD-L1.

    Адриана Т. Лопес, Триша Ханна, Нина К. Антонова, Клэр Одри-Баян, Лариса Дж. Гескин

    Стратегии вторичной профилактики немеланомного рака кожи.

    Адриана Т. Лопес, Ричард Д. Карвахал, Лариса Дж. Гескин

    Индуцированное интерфероном-α2b подавление STAT3 в миелоидных супрессорных клетках грибовидного микоза

    Лариса Дж.Гескин, Олег Э. Акилов, Майкл К. Шовальтер, Луи Д. Фало

    Иммунофенотипическая вариация CD56 у одного пациента с бластным плазмоцитоидным новообразованием дендритных клеток

    Самира Хусейн, Лариса Гескин, Катарина Шоу

    Терапевтическое уменьшение количества клеток иммуносупрессия при грибковом микозе и синдроме Сезари

    Лариса Дж. Гескин, Олег Э. Акилов, Сунью Квон, Майкл К. Шовальтер, Саймон С. Уоткинс, Тереза ​​Л. Уайтсайд, Лиза Х. Баттерфилд, Луис Д.Falo

    Метод высокочувствительного секвенирования с захватом вирома VirCapSeq-VERT идентифицирует частичные некодирующие последовательности, но не обнаруживает активную вирусную инфекцию в кожной Т-клеточной лимфоме.

    Мэри Э. Андерсон, Дороттия Надь-Сакаль, Комал Джайн, Кристина С. Патроне, Марк Г. Фраттини, В. Ян Липкин, Лариса Дж. Гескин

    Терапевтическое и прогностическое значение PARP-1 при запущенных грибковых микозах и синдроме Сезари .

    Дэвид М. Лемчак, Свати Банерджи, Шаунак С. Дигамбар, Брайан Л.Худ, Томас П. Конрадс, Ярослав Едрих, Лариса Дж. Гескин, Олег Э. Акилов

    Рецидив протуберанской дерматофибросаркомы, леченный неоадъювантным мезилатом иматиниба с последующей микрографической операцией по Моосу.

    Наталья М. Фонтесилла, Николь В. Киттлер, Лариса Дж. Гескин, Фарамарц Х. Сами, Джордж В. Нидт, Томас Имахиеробо, Гэри К. Шварц, Мэтт Ингам, Джесси М. Левин

    Глобальные модели оказания медицинской помощи на продвинутом уровне стадия грибовидного микоза / синдром Сезари: многоцентровое ретроспективное последующее исследование, проведенное Международным консорциумом кожной лимфомы.

    П. Куаглино, М. Мауле, Его Величество Принц, П. Порку, С. Хорвиц, М. Дювич, Р. Талпур, М. Вермеер, М. Багот, Дж. Гитарт, Е. Пападавид, Дж. А. Санчес, Е. Ходак, М. Сугайя, Е. Берти, П. Ортис- Ромеро, Н. Пимпинелли, О Сервитье, А. Пилери, П. Л. Зинзани, Т. Эстрах, Р. Ноблер, Р. Стадлер, М. Т. Фиерро, С. Альберти Виолетти, И. Амитай-Лаиш, К. Антониу, С. Аструа, С. Чаганти, Ф. Чайлд, А. Комбалия, С. Фаббро, П. Фава, В. Гранди, С. Йонак, Е. Мартинес-Эскала, М. Хетерпал, Э. Дж. Ким, С. Маккормак, Т. Миягаки, Д. Мияширо, С. Моррис, К. Муньеса, В. Николау, Г. Огнибене, Ф. Онида, С Оселла- Абате, С. Поркерт, К. Постиго-Льоренте, С. Рам-Вольф, С. Риберо, К. Роджерс, М. Санлоренцо, Р. Странценбах, Н. Спаккарелли, А. Стивенс, Д. Зугна, А. Х. Ладья, Л. Дж. Гескин, Р. Виллемзе, С. Уиттакер, Р. Хоппе , J Scarisbrick, Y Kim

    Брентуксимаб ведотин или выбор врача при CD30-положительной кожной Т-клеточной лимфоме (ALCANZA): международное открытое, рандомизированное, фаза 3, многоцентровое исследование

    H.Майлз Принс, Юн Х. Ким, Стивен М. Хорвиц, Рейнхард Даммер, Джулия Скарисбрик, Пьетро Куаглино, Пьер Луиджи Зинзани, Паскаль Вольтер, Хосе Санчес, Пабло Л. Ортис-Ромеро, Олег Э. Акилов, Лариса Дж. Гескин, Джудит Тротман, Керри Тейлор, Стефан Далле, Майкл Вайхенталь, Ян Валевски, Дэвид Э. Фишер, Брижит Дрено, Рудольф Штадлер, Татьяна Фельдман, Тимоти М. Кузель, Инхуэй Ван, Мария Коринна Паланка-Вессельс, Эрин Загадайлово, Уильям Л. Трегадайлов , Венвен Чжан, Хуэй-Минь Линь, И Лю, Дирк Хюбнер, Мередит Литтл, Шон Уиттакер, Мадлен Дювич, Дэвид Джоске, Ян Д.Льюис, Констанц Йонак, Франц Траутингер, Оливер Бехтер, Доминик Брон, Владмир Клаудио К. де Лима, Хосе Антонио Санчес, Ричард Класа, Мартин Баго, Мари Бейло-Барри, Мишель Д’Инкан, Флоран Гранж, Ян П. Николай, Марион Wobser, Chalid Assaf, Carmen Loquai, Michele Spina, Alberto Bosi, Pier Paolo Fattori, Aleksandra Grzanka, Andres Lopez-Hernandez, Jose Juan Rifon Roca, Silvana Novelli Canales, Timothy M Illidge, Rod Johnson, Stephen Morris, Pam McKay, O. Акилов, Стив Хорвиц, Барбара Про, Тимоти Кузел, Адам Лернер, Герберт Эрадат, Любомир Сокол, Дэвид К.Фишер, Сара Хью

    Пейзаж биомаркеров при грибковом микозе и синдроме Сезари

    Бриттани О. Далмадж, Лариса Дж. Гескин, Джоан Гитарт, Олег Э. Акилов

    Клинические идеи и новые стратегии лечения Т-клеточной лимфомы кожи.

    Кристина С. Патроне, Лариса Дж. Гескин

    Скрининг рака кожи: рекомендации для руководств по скринингу на основе данных и обзор разногласий Рабочей группы США по профилактическим услугам.

    Мэрайя М.Джонсон, Санси А. Личман, Лиза Г. Аспинуолл, Ли Д. Кранмер, Клара Куриэль-Левандровски, Вернон К. Сондак, Клара Э. Стемведель, Сьюзан М. Светтер, Джон Т. Ветто, Тоня Л. Боулз, Роберт П. Деллавалле, Лариса Дж. Гескин, Дуглас Гроссман, Кеннет Ф. Гроссманн, Джейсон Э. Хоукс, Джоан М. Джетер, Кэролайн К. Ким, Джон М. Кирквуд, Аарон Р. Мангольд, Фрэнк Л. Мейскенс, Майкл Э. Мин, Келли С. Нельсон, Майкл В. Пипкорн, Брайан Поллак, Джун К. Робинсон, Артур Дж. Собер, Шеннон С. Троттер, Сурадж С. Венна, Санджив С.Агарвала, Рода М. Алани, Брюс Дж. Авербук, Анна Бар, Мирна Бечевич, Нил Ф. Бокс, Уильям Э. Карсон, Памела Б. Кэссиди, Суэфи К. Чен, Эмили Ю. Чу, Даррел Л. Эллис, Лаура К. Феррис, Дэвид Э. Фишер, Кари Кендра, Дэвид Х. Лоусон, Филип Д. Леминг, Ким Марголин, Светомир Н. Маркович, Мэри К. Мартини, Дебби Миллер, Дебджани Сахни, Уильям Х. Шарфман, Дженнифер А. Штайн, Александр Дж. Стратигос, Ахмад А. Тархини, Мэтью Х. Тейлор, Оливер Дж. Виско, Майкл К. Вонг

    Многоцентровое испытание фазы II орального хизиностата, ингибитора гистоновой деацетилазы, у пациентов с ранее леченным грибковым микозом стадии IB – IVA / Синдром Сезари †

    LJ Geskin, Y Elsayed

    Терапия ромидепсином в течение 5 лет в клинических условиях в реальных условиях.

    Сьюзан Э. Бейтс, Лариса Дж. Гескин

    Стабилизация болезни с помощью пембролизумаба при метастатической акральной меланоме на фоне аутоиммунного буллезного пемфигоида

    Кристен М. Бек, Джоанна Донг, Лариса Дж. Гескин, Винсент Бельтрани, Ричард Г. Фелпс , Ричард Д. Карвахал, Гэри К. Шварц, Ивонн М. Сенгер, Робин Д. Гартрелл

    Моноклональные антитела.

    Гескин, Л. Дж.

    Фунгоидный микоз на стадии опухоли у ребенка.

    Бриттани О. Далмадж, Дженнифер Вилласеньор-Парк, Джонхан Хо, Лариса Дж.Гескин, Лиза М. Грандинетти

    Ромидепсин при периферической и кожной Т-клеточной лимфоме: механистические последствия из клинических и корреляционных данных

    Сьюзен Э. Бейтс, Робин Эйш, Александр Линг, Дуглас Р. Розинг, Мария Л. Тернер, Стефания Питталуга , Х. Майлз Принс, Марк Киршбаум, Стивен Л. Аллен, Жасмин Зейн, Лариса Дж. Гескин, Дэвид Джоске, Лесли Попплуэлл, Эдвард В. Коуэн, Элейн С. Джаффе, Джин Николс, Салли Кеннеди, Сет М. Стейнберг, Дэвид Дж. Ливер, Луиза С. Шоу, Кэрин Стейкли, Джон Райт, Тито Фоджо, Томас Литман, Ричард Пикарц

    Случай лимфоматоидного гранулематоза с кожными поражениями.

    Шейла Шайгани, Николь А. Вайц, Самира Хусейн, Лариса Дж. Гескин, Марк Э. Гроссман

    Черная кошка в темной комнате: отсутствие непосредственно онкогенного вируса не исключает роли инфекционного агента в кожном T Патогенез -клеточной лимфомы

    BO Dulmage, H. Feng, Ezra D. Mirvish, Larisa J. Geskin

    Интерлейкин-13 сверхэкспрессируется в клетках Т-клеточной лимфомы кожи и регулирует их пролиферацию.

    Лариса Юрьевна Гескин, Сара Вирагова, Донна Б.Штольц, Патриция Фушиотти

    Гангренозная пиодермия у пациента с кожной Т-клеточной лимфомой

    Рэнди Танг, Лариса Дж. Гескин, Марк Э. Гроссман

    Новая терапевтическая комбинация демонстрирует не только аддитивный эффект при кожной Т-клеточной лимфоме

    Бриттани. O. Dulmage, Sara K. Story, Louis D. Falo, Larisa J. Geskin

    Окончательные результаты многоцентрового исследования фазы II ингибитора пуриновой нуклеозидфосфорилазы (PNP) фородезина у пациентов с распространенными кожными Т-клеточными лимфомами (CTCL) (Грибовидный микоз и синдром Сезари)

    Рейнхард Даммер, Мадлен Дювик, Дж.Скарисбрик, Элиза А. Олсен, Сима Розати, Нина Эггманн, Симона М. Голдингер, К. Хатчинсон, Лариса Дж. Гескин, Тимоти М. Иллидж, Э. Джулиано, Дж. Элдер, Юн Х. Ким

    Сравнительный протеомный анализ обнаруживает уникальные белковый состав опухоли среди подтипов меланомы с чистым десмопластическим и поверхностным распространением.

    Майкл К. Шовальтер, Бриттани О. Далмэйдж, Джонхан Хо, Джон Ву, Луи Д. Фало, Лариса Дж. Гескин

    Четкие соответствующие возрасту профили сывороточных биомаркеров у пациентов с кожной Т-клеточной лимфомой.

    Лариса Дж. Гескин, Олег Э. Акилов, Ян Линь, Анна Локшина

    Неслучайное географическое распределение пациентов с кожной Т-клеточной лимфомой в районе Большого Питтсбурга

    Жаклин Ф. Моро, Жанин М. Буханич, Якоб Гескин З., Акилов Олег Евгеньевич, Гескин Лариса Юрьевна

    Успешная десенсибилизация к брентуксимаб ведотину после реакции гиперчувствительности.

    Сара К. Стори, Андрей А. Петров, Лариса Дж. Гескин

    Уроки, извлеченные из профилирования экспрессии генов кожной Т-клеточной лимфомы.

    BO Dulmage, Larisa J. Geskin

    Продолжительность ответа у пациентов с кожной Т-клеточной лимфомой, получавших денилейкин дифтитокс: результаты 3 исследований фазы III

    Мадлен Дювик, Лариса Дж. Гескин, Х. Майлз Принс

    инфекционные агенты при кожной Т-клеточной лимфоме: факты и противоречия

    Джуда Дж. Мирвиш, Ребекка Г. Померанц, Луи Д. Фало, Лариса Дж. Гескин

    ALCL, ассоциированная с грудным имплантатом: уникальная сущность в спектре лимфопролиферативных CD30 + Заболевания

    Сара К.Story, Майкл К. Шовальтер, Лариса Дж. Гескин

    Упреждающее введение лейковорина сводит к минимуму токсичность пралатрексата без ущерба для эффективности.

    Эллен Кох, Сара К. Стори, Лариса Дж. Гескин

    Кожные проявления неуточненной периферической Т-клеточной лимфомы могут указывать на активность заболевания и прогнозировать ответ на терапию

    Майкл К. Шовальтер, Олег Э. Акилов, Сара К. История, Лариса Дж. Гескин

    Долгосрочное наблюдение и выживаемость пациентов с кожной Т-клеточной лимфомой, получавших экстракорпоральный фотоферез

    Роберт Кноблер, Мадлен Дювик, Кристиан Кверфельд, Дэвид Дж.Штраус, Стивен Хорвиц, Жасмин Зайн, Франсин М. Фосс, Тимоти М. Кузель, Ким Кэмпбелл, Лариса Дж. Гескин

    Неблагоприятные эффекты денилейкина дифтитокса и их лечение у пациентов с кожной Т-клеточной лимфомой.

    Сью Энн МакКанн, Олег Э. Акилов, Лариса Дж. Гескин

    Терапия низкодозным электронно-лучевым излучением и ромидепсином при симптоматических поражениях кожной Т-клеточной лимфомы

    О. Акилов, К. Грант, Робин Фрай, С. Бейтс , Ричард Пиекарц, Лариса Дж. Гескин

    Устойчивость клеток Сезари к апоптозу, индуцированному TNF-α, частично опосредуется потерей TNFR1 и высоким уровнем экспрессии IER3.

    Олег Э. Акилов, Мей X. Ву, Ирина В. Устюгова, Луи Д. Фало, Лариса Дж. Гескин

    Перестройки гена β-цепи клонального Т-клеточного рецептора в дифференциальной диагностике лимфоматоидного папулеза на основе кожных метастазов узлового анапласта Крупноклеточная лимфома

    Лиза М. Грандинетти, Лариса Гескин, Раджу К. Пиллай, Джеффри А. Кант

    Клинические конечные точки и критерии ответа при грибовидном микозе и синдроме Сезари: согласованное заявление Международного общества кожных лимфом, США. Кожный Консорциум лимфомы и Целевая группа по кожной лимфоме Европейской организации по исследованию и лечению рака.

    Элиза А. Олсен, Шон Уиттакер, Юн Х. Ким, Мадлен Дювич, Х. Майлз Принс, Стюарт Р. Лессин, Гэри С. Вуд, Рейн Виллемзе, Мари-Франс Демьер, Никола Пимпинелли, Мария Грация Берненго, Пабло Л. Ортис-Ромеро, Мартина Багот, Тереза ​​Эстрах, Джоан Гитарт, Роберт Ноблер, Хосе Антонио Санчес, Кейджи Ивацуки, Макото Сугая, Рейнхард Даммер, Марк Р. Питтелькоу, Ричард Т. Хоппе, Сарита Р.С. Паркер, Лариса Дж. Гескин, Лорен Пинтер-Браун, Майкл Жирарди, Гюнтер Бург, Аннамари Ранки, Маартан Вермеер, Стивен М.Хорвиц, Питер Хилд, Стив Розен, Лоренцо Черрони, Б. Дрено, Эрик К. Вондерхайд

    Вакцинация макрофагами, обработанными фотодинамической терапией, индуцирует высоко подавляющие Т-регуляторные клетки.

    Олег Э. Акилов, Мей Х. Ву, Юнчжу Цзинь, Чжуоян Чжоу, Лариса Дж. Гескин, Луис Д. Фало, Тайяба Хасан

    Многоцентровое интервенционное исследование фотофереза ​​на ранних стадиях грибкового микоза.

    Рахшандра Талпур, Мари Фрэнсис Демьер, Лариса Дж. Гескин, Эльма Д. Барон, Сильвина Пульезе, Келли В.Юбэнк, Джон А. Зик, Дональд Р. Миллер, Майкл Д. Тарп, Кимберли А. Бохьянен, Мадлен Дувик

    Терапевтические достижения при кожной Т-клеточной лимфоме.

    Олег Евгеньевич Акилов, Лариса Гескина

    Инфекционные агенты при Т-клеточной лимфоме кожи.

    Эзра Д. Мирвиш, Ребекка Г. Померанц, Лариса Дж. Гескин

    Новый подход к профилированию экспрессии генов при синдроме Сезари.

    Ребекка Г. Померанц, Эзра Д. Мирвиш, Г. Эрдос, Луи Д. Фало, Лариса Дж. Гескин

    Кожные реакции на ингибиторы рецепторов эпидермального фактора роста.

    Ребекка Г. Померанц, Эзра Д. Мирвиш, Лариса Дж. Гескин

    Влияние возраста и пола на причины поиска и ожидаемые преимущества скрининга рака кожи.

    Райан Андрулонис, Аарон М. Секрест, Шон Т. Макгуайр, Лариса Дж. Гескин, Лаура К. Феррис

    Посттрансплантационная кожная Т-клеточная лимфома: отчеты о клинических случаях и обзор связи использования ингибитора кальциневрина с риском посттрансплантационного лимфопролиферативного заболевания.

    Ребекка Г. Померанц, Лорен С.Кэмпбелл, Дражен М. Юкич, Лариса Дж. Гескин

    Экспрессия CD30 и пролиферативная фракция у нетрансформированных грибовидных микозов.

    Джеймс Т. Эдингер, Бет З. Кларк, Брайан Э. Пуцевич, Лариса Дж. Гескин, Стивен Х. Свердлов

    Оценка долгосрочной переносимости и клинической пользы вориностата у пациентов с распространенной кожной Т-клеточной лимфомой.

    Мадлен Дювич, Элиза А. Олсен, Дебра Л. Бренеман, Тереза ​​Р. Пачеко, Сарита Р.С. Паркер, Эрик К. Вондерхайд, Рэйчел Абуав, Джастин Л.Рикер, Сайед Ризви, Конг Чен, Кэтлин Буало, Александра Гунченко, Сезар Санс-Родригес, Лариса Дж. Гескин

    Межведомственное исследование фазы II ингибитора гистон-деацетилазы ромидепсин в качестве монотерапии для пациентов с кожной Т-клеточной лимфомой Ричард

    Пекарц, Робин Фрай, Мария Л. Тернер, Джон Райт, Стивен Л. Аллен, Марк Киршбаум, Жасмин Зейн, Х. Майлз Принс, Джон П. Леонард, Лариса Дж. Гескин, Крейг Б. Ридер, Дэвид Джоске, Уильям Д. Фигг, Эрин Р. Гарднер, Сет М.Steinberg, Elaine S. Jaffe, Maryalice Stetler-Stevenson, Stephen Lade, A. Tito Fojo, Susan E. Bates

    Безопасность новой единой интегрированной закрытой системы фотофереза ​​у пациентов с кожной Т-клеточной лимфомой

    Лариса Гескин , MD

    Алемтузумаб подкожно для лечения синдрома Сезари у пожилых людей.

    Лапо Алинари, Лариса Дж. Гескин, Терренс Грейди, Роберт А. Байокки, Марк А. Бехтель, Пьерлуиджи Порку

    Ацитретин для лечения кожных токсических эффектов, вызванных ингибитором EGFR.

    Ребекка Г. Померанц, Родольфо Э. Чиринос, Луи Д. Фало, Лариса Дж. Гескин

    Сравнение ECP и PUVA при лечении кожной Т-клеточной лимфомы.

    Л Гескина

    Болезненная язва на груди.

    Кристина Палей, Джон МакСорли, Фаррух Азми, Лариса Дж. Гескин

    Кожная B-клеточная псевдолимфома, вызванная парафенилендиамином.

    Кристина Палей, Лариса Дж. Гескин, Мэтью Дж. Зирвас

    Адъювантная терапия меланомы.

    Лариса Ю.Гескин, К. Ромен Браун, Джон М. Кирквуд

    Подногтевой экзостоз третьего пальца стопы

    Вакас Ильяс, Лариса Дж. Гескин, Аарон К. Джозеф, Марк П. Серали

    Использование легкой цепи в анти-двухцепочечной ДНК B Подмножества клеток: роль в определении судьбы клеток

    Линда Спатц, Владимир Саенко, Андрей Илиев, Лори Джонс, Лариса Гескин, Бетти Даймонд

    Эффективность могамулизумаба у ранее леченных пациентов с менее распространенными грибковыми микозами: результаты исследования MAVORIC.

    Проблемы лечения кожной лимфомы

    AE Larisa – Record vs 1.FC Nuremberg

    Record vs …

    1.FC НюрнбергPS KalamataЭвертон FCIraklis ThessalonikiServette FCDynamo MoscowAO XanthiBlackburn RoversPanionios AthensPanathinaikos AthensApollon SmyrnisIonikos NikeasAris ThessalonikiNeuchâtel Xamax FCSO PiraeenOlympâtel Xamax FCSO PiraeenPetersburgAPO FostirasUC SampdoriaAZ AlkmaarPAOK ThessalonikiAkratitos Ano LiosionPanachaiki GEPierikos KateriniVeria NPSAEK AthensFS KozaniEthnikos PiraeusPAS GianninaAPO LevadiakosProodeftiki NeoleaPaniliakos PyrgosAPOEL NicosiaAO EgaleoAtromitos AthenGS KallitheaKayserisporKR ReykjavíkPanelefsiniakos AOPanserraikosAgrotikos AsterasAO KavalaApollon PontouEthnikos AsterasBFC SiófokDoxa DramasGS IlioupolisAO AcharnaikosAO Агиос NikolaosAO TrikalaPAS KorinthosPAS Ламия 1964Nafpaktiakos AsterasVyzas MegaronAnagennisi KarditsasAthinaikos ASFAS NaousaPoseidon АСЗ MichanionasOlympiakos VolouAS EdessaikosGAS Ialysos 1948AOK KerkyraGS ErgotelisAGS KastoriaNiki VolouAS RodosIlysiakos AOPanetolikos GFSPoseidon Неон PoronAsteras TripolisILTEX LykiThrasyvoulos FylisPanthrakikos KomotiniAO ChaniaDiagoras RodouPASA IrodotosPanegialios GSAPS ZakynthosAnagennisi GiannitsonEthnikos KaterinisMakedonikos NeapolisTyrnavos 2005AS Fokikos AmfissasAO PlataniasAnagennisi EpanomisAEL KalloniIraklis PsachnonP S SerresAS RouvasPAE EginiakosPAE ChaniaDoxa VyronosAO ХалкидонаVolos NPSAS Ampelokipon

    Результатов с:

    не имеет значения20 / 2119/2018/1917/1816/1715/1614/1512/1311/1210/1109/1008/0907/0806/0705/0604/0503/0402/0301/0200/0199/0098/9997/9896 / 9795/9694/9593/9492/9391/9290/9189/9088/8987/8886/8785/8684/8583/8482/8381/8280/8179/8078/7974/7573/74

    Конкуренция:

    ВсеЛига Европы УЕФА КвалификацияКубок ЕвропыUEFA CupCup Winners` CupFootball League NorthSuper CupSL1 Play-outKypello ElladasA ‘Ethniki PlatzierungsspieleFL Play-offSL1 Play-offFootball LeagueSuper League 1Super League 2Balkan-Cup

    UI Cup

    Будний день:

    ВсеПятницаСубботаВоскресеньеПонедельник ВторникСреда Четверг

    Место проведения:

    ВсеТолько домашние игрыТолько выездные игры

    Результат:

    ВсеПораженияНичьиПобеды

    Период:

    Результаты борьбы США

      48 кг / 105.5 фунтов. 
    Золото - Лилия Каскарацова (Россия).
    Серебро - Стефани Мурата (США).
    Бронза - Otgonmar4gal Nyamsuren (Монголия)
    Бронза - Лариса Ооржак (Россия).
    5 место - Аялана Куулар (Россия)
    5 место - Екатерина Евдокимова (Россия)
    7 место - Хирома Икеда (Япония)
    8 место - Елена Грошева (Россия)
    9 место - Наталья Вайлиева (Россия)
    10 место - Кларисса Чун (США)
    
    Золотой матч - Каскарацова дек. Мурата, 3-0, 5-1
    Матч за бронзу - Наямсуран дек. Куулар, 1-1, 4-0, 4-0
    Матч за бронзу - Ооржак дек.Евдокимова, 6-0, 7-0
    
      51 кг / 112,25 фунта. 
    Золото - Наталья Смирнова (Россия).
    Серебро - Дженни Вонг (США).
    Бронза - Брижит Вагнер (Германия).
    Бронза - Инга Карамчакова (Россия).
    5 место - Ольга Гилева (Россия)
    5 место - Алена Адашинская (Россия)
    7 место - Дарья Данилова (Россия)
    8 место - Марина Шишкина (Россия)
    9 место - Юлия Карамачева (Россия)
    10 место - Любовь Олейникова (Россия)
    
    Золотой матч - Смирнова дек. Вонг, 1-1, 1-3, 1-0
    Матч за бронзу - Вагнер дек.Гилева, штырь 1-го периода
    Матч за бронзу - Карамчакова дек. Асашинская, 3-2, 0-1, 4-0
    
      55 кг / 121 фунт. 
    Золото - Наталья Гольц (Россия)
    Серебро - Джессика Пейхтлен (Германия).
    Бронза - Ольга Смирнова (Россия).
    Бронза - Евгения Корякина (Россия).
    5 место - Чанцальняма Амгаланбатор (Монголия)
    5 место - Мирует Дынбаева (Казахстан)
    7 место - Ольга Оршич (Россия)
    8 место - Наталья Огородникова (Россия)
    9 место - Алена Федорова (Россия)
    
    Золотой матч - Гольц дек.Пейхтлен, 3-0, 6-0
    Матч за бронзу - Смирнова пина Амгаланбатор, 1-й период
    Матч за бронзу - Корякина дек. Дынбаева, 1-1, 1-1, 1-0
    
      59 кг / 130 фунтов. 
    Золото - Марси Ван Дузен (США).
    Серебро - Лариса Канаева (Россия).
    Бронза - Дарья Карпенко (Казахстан).
    Бронза - Виктория Загайнова (Россия).
    5 место - Наталья Иванова (Россия)
    5 место - Салли Робертс (США)
    7 место - Айжан Исмагулова (Казахстан)
    
    Золотой матч - Ван Дузен дек. Канаева, 1-0, 2-1
    Матч за бронзу - Карпенко дек.Иванова, 1-0, 1-0
    Матч за бронзу - Загайнова дек. Робертс, 1-3, 6-1, 3-1
    
      63 кг / 138,75 фунта. 
    Золото - Алена Карташова (Россия).
    Серебро - Любовь Волосова (Россия).
    Бронза - Лилия Доронина (Россия).
    Бронза - Анна Половнева (Россия).
    5 место - Ирина Богданова (Россия)
    5 место - Мария Смолякова (Россия)
    7 место - Ольга Черкашева (Казахстан)
    8 место - Мария Качина (Россия)
    9 место - Одмоо Цендсурэн (Монголия)
    
    Золотой матч - Карташова дек.Волосова, 3-0, 3-0
    Матч за бронзу - Доронина дек. Богданова, 2-1, 4-1
    Матч за бронзу - Половнева дек. Смолякова, 1-0, 2-0
    
      67 кг / 147,5 фунтов. 
    Золото - Наталья Куксина (Россия).
    Серебро - Карина Шадаян (Россия).
    Бронза - Алена Переполкина (Россия).
    Бронза - Хироэ Судзуки (Япония)
    5 место - Светлана Михайлина (Россия)
    5 место - Евгения Ибраева (Россия)
    7 место - Юлия Бартновская (Россия)
    8 место - Анастасия Дежнева (Россия)
    
    Золотой матч - Куксина дек.Шадаян, 1-0, 0-1, 1-0
    Матч за бронзу - Переполкина дек. Михайлина, 3-0, 3-0
    Матч за бронзу - Судзуки дек. Ибраева, 1-3, отметка во 2 периоде
    
      72 кг / 158,5 фунтов. 
    Золото - Дарья Назарова (Россия).
    Серебро - Светлана Саенко (Украина).
    Бронза - Анна Шамова (Россия).
    Бронза - Алена Стародубцева (Россия).
    5 место - Юкия Бумбошикина (Россия)
    5 место - Айрис Смит (США)
    7 место - Ольга Жанибекова (Казахстан)
    8-е место - Анита Шетцле (Германия)
    
    Золотой матч - Назарова дек.Саенко, 1-0, 2-0
    Бронза - Шамова - Бумбошикина, 4: 0, - во 2 периоде
    Бронза - Стародубцева - Смит, 1: 0, - во 2 периоде
    
      Представления в США 
    
      48 кг / 105,5 фунтов. - Стефани Мурата, Колорадо-Спрингс, штат Колорадо (Sunkist Kids), 2-е место, .
    ПОБЕДА Лорисса Ооржак (Россия), 2: 0, 3: 1
    ПОБЕДА Кларриса Чун (США), 4: 0, отметка во 2-м периоде
    LOSS Лилия Каскарацова (Россия), 0-3, 1-5
    
      48 кг / 105,5 фунтов. - Кларисса Чун, Колорадо-Спрингс, Колорадо.(Sunkist Kids), 5-я 
    ПРОБЛЕМА Стефани Мурата (США), 0: 4, связка во 2-м периоде
    LOSS Лорисса Ооржак (Россия), 0: 1, 0: 4
    
      51 кг / 112,25 фунта. - Дженни Вонг, Колорадо-Спрингс, Колорадо (Sunkist Kids), 2-е место 
    ПОБЕДА Ольга Гилева (Россия), 0-1, 5-0, 7-1
    ПОБЕДА Бригетт Вагнер (Германия) - 1: 0, 2: 0
    LOSS Наталья Смирнова (Россия), 1-1, 3-1, 0-1
    
      59 кг / 130 фунтов. - Марси Ван Дузен, Колорадо-Спрингс, штат Колорадо (Sunkist Kids), чемпион 
    ПОБЕДА Салли Робертс (США), 0: 3, 1: 0, 2: 0
    WIN Виктория Загайнова (Россия), 3-4, 6-0, 2-0
    ПОБЕДА Лариса Канаева (Россия), 1-0, 2-1
    
      59 кг / 130 фунтов.- Салли Робертс, Колорадо-Спрингс, штат Колорадо (Gator WC), 5-я улица 
    ПРОБЛЕМА Марси Ван Дузен (США), 3: 0, 0: 1, 0: 2
    LOSS Виктория Загайнова (Россия), 3-1, 1-6, 1-3
    
      72 кг / 158,5 фунтов. - Айрис Смит, Колорадо-Спрингс, штат Колорадо (армия США), 5-я улица 
    ПОБЕДА Анита Шетцле (Германия), 0: 2, 1: 1, 1: 1
    LOSS Дарья Назарова (Россия), контакт 0:25
    LOSS Алена Стародубцева (Россия), палец, 0: 1, 1:58
    
     
    .

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *