Швагерус юлия: Юлия Швагерус | Facebook

Антон Швагерус ВКонтакте, Киселевск, Россия, id19176675

Действительно смешно

Добродушные шутники
Добродушное сообщество в каждом доме. Наше сообщество создано, чтобы каждый мог поднять себе настроение на целый день!

Империя Юмора
Будет весело

Чёткие приколы
У нас вы найдёте массу прикольных картинок и фотографий, интересные новости и приколы. Мы не позволим вам заскучать!

Digit world – в мире технологий

Улетные приколы

ПРАВИЛА БИЗНЕСА | THE BUSINESS RULES

Психология Джокера
Джокер — гений, хоть и гений зла. Его нельзя осуждать, он — психолог, изучающий все мерзкие составляющие людских душ… Сообщество для Вас!

Кинолюбители – Лучшие фильмы
Все самое главное в мире кинематографа. Самые главные события в мире кино, новости в мире, главные новинки кино и многое другое.

Это интересно!
Познавательная страница о самом интересном.

Интересные Факты

Сообщество для тех, кто каждый день хочет узнавать что-то новое: о нашей планете, обществе, культуре, науке, достижениях и многом другом.

Книги
Книги Цитаты Литература

Бизнес Инфо
Наша цель: создавать то, что будет вдохновлять и информировать людей, желающих добиться финансовой свободы и успеха. Лучший мотивационный контент: слова, которые зажгут в тебе пламя.

Смешно До Боли ツ

Программист
Наше сообщество посвящено программированию и лайфхакам в сфере программирования и компьютерной техники. Здесь Вы найдете уроки по программированию и научитесь писать код. Ежедневно мы публикуем интересный контент, который поможет Вам стать более продвинуты в IT технологиях.

Just English
Сообщество для тех, кто изучает, знает и любит английский язык. Ежедневный юмор, полезная информация, интересные факты. Возможность общения с носителями языка и улучшения владения английским.

Отзывы Салон Эвелин

https://evelin.obiz.ru, https://салонэвелин.рф

Наш рейтинг: 1.5

Отзывы и рейтинг Салон Эвелин

Ознакомиться с отзывами и репутацией компании Салон Эвелин (сайт evelin.obiz.ru, салонэвелин.рф) Вы можете на данной странице. Средняя оценка Салон Эвелин (массажный салон, салон красоты, косметология) на основании 12 отзывов – 1.5

Салон Эвелин

Официальный сайт компании Салон Эвелин – evelin.obiz.ru (салонэвелин.рф)

Основные направления деятельности Салон Эвелин: массажный салон, салон красоты, косметология.

Салон Эвелин располагается по адресу: Москва, Ростокинская улица, 1 рядом с метро Ростокино, Ботанический сад, Улица Сергея Эйзенштейна.  Ближайшие остановки: Ростокинская улица, Сельскохозяйственная улица, Улица Докукина, Акведук.

Здесь Вы можете ознакомиться с честными отзывами о компании Салон Эвелин (в том числе негативными и отрицательными), о ее услугах (массажный салон, салон красоты, косметология), а также увидеть мнение настоящих покупателей и клиентов Салон Эвелин.

В компании Салон Эвелин работают следующие специалисты: Нина Шукайло (Косметолог), Галина Обаль (Администратор), Денис Скобелев (Парикмахер, стилист-имиджмейкер), Юлия Швагерус (Визажист, косметолог), Юлия Трошко (Администратор), Кристина Терехова (Мастер ногтевого сервиса), Елена Петрова (Мастер ногтевого сервиса), Анна Чаган (косметолог, Визажист). Вы можете прочесть отзывы о компании Салон Эвелин и её специалистах.

Связаться с сотрудниками Салон Эвелин можно по телефону: +7 (499) 649-43-18.
График работы: Ежедневно: 09:00 – 21:00.
Больше информации об услугах Салон Эвелин Вы найдете на сайте компании – evelin.obiz.ru, салонэвелин.рф или в соцсетях – https://www.instagram.com/salonevelin.rf/


Теги

Отзывы Салон Эвелин, Отзывы Салон Эвелин салон красоты, Отзывы Салон Эвелин косметология, Отзывы Салон Эвелин массажный салон, Отзывы evelin.obiz.ru, салонэвелин.рф, Настоящие отзывы Салон Эвелин, Плохие отзывы Салон Эвелин, Рейтинг Салон Эвелин, Реальные отзывы Салон Эвелин, Отзывы покупателей Салон Эвелин, Отзывы клиентов Салон Эвелин, Негативные отзывы Салон Эвелин.

Артикул компании: 242854233CF

Московским таксистам ограничат переработки

Фото с сайта stmedia24.ru

С 1 августа в Москве начнет работать обязательная комплексная информационная система «Аналитика работы такси» (КИС «АРТ»). В ней обязаны будут зарегистрироваться все водители. Система будет следить, чтобы водитель работал не более 40 часов в неделю, проходил медосмотр и техосмотр, оплачивал штрафы, оформлял необходимые документы и не имел судимости за тяжкие преступления. Председатель координационного совета профсоюза «Таксист» Андрей Попков предрек коллапс всей сферы. 

Он считает, что система КИС «АРТ» несовершенна с технической точки зрения, к тому же ее введение не отвечает никаким федеральным нормативно-правовым актам.

— За восемь часов человек отбивает только аренду и бензин. Если даже сократится количество водителей с учетом ухода мигрантов, то агрегаторы не захотят уходить в убытки и компенсируют их за счет остальных водителей, повысив проценты, — говорит он ФАН. 

Руководитель центра компетенций международного Евразийского форума такси Станислав Швагерус не согласен с таким выводом. 

– Действительно, система КИС «АРТ» позволит четко контролировать количество времени, в течение которого водитель управляет автомобилем и выполняет заказы, — отметил Швагерус. — Но, к сожалению, большинство водителей даже не открывают нормативно-правовые акты, которые регулируют их работу. 40 часов в неделю, на которые все ссылаются, — это базовый уровень, установленный федеральным законодательством. При этом приказ 424 «Об утверждении особенностей режима рабочего времени и времени отдыха, условий труда водителей автомобилей» Министерства транспорта расширяет время работы до 12 часов в день.

Система не позволит работать по 18-20 часов в день, что существенно повысит безопасность водителя и пассажира. Швагерус напомнил, что за 7 месяцев 2021 года в Москве произошло почти 800 дорожно-транспортных происшествий с участием такси, и в большинстве из них пострадали пассажиры.  

Региональный этап Всероссийского конкурса социальной рекламы “Стиль жизни – здоровье! 2020” завершен

С 1 сентября по 16 октября 2020 года прошел региональный этап Всероссийского конкурса социальной рекламы в области формирования культуры здорового и безопасного образа жизни обучающихся  “Стиль жизни – здоровье! 2020”.

Конкурс направлен на повышение эффективности формирования культуры здорового и безопасного образа жизни, профилактики аддиктивного поведения среди обучающихся образовательных организаций; внедрение современных форм и методов просвещения, обновление наглядно-методического инструментария профилактической деятельности, повышение воспитательного потенциала образовательных организаций.

Участие в конкурсе способствовало развитию социальной инициативы на основе сотрудничества обучающихся и их педагогов, родителей (законных представителей) в процессе подготовки конкурсной работы.

Конкурс, привлекший внимание обучающихся к социально значимым проблемам общества, вызвал большой интерес. В адрес организационного комитета регионального этапа было направлено 92 работы от 283 обучающихся образовательных организаций Кемеровской области в возрасте от 8-18 лет.

Победителями и лауреатами регионального этапа Конкурса стали:

 

в номинации Социальный видеоролик по пропаганде здорового и безопасного образа жизни, направленный на профилактику зависимого поведения обучающихся”

 

8-12 лет

1 место

“Семья и школа: воспитываем детей правильно” авторы Илькина Екатерина, Чепкасов Григорий, Храпцова Милана, МАОУ «Гимназия № 42», г. Кемерово

2 место

“Со спортивным туризмом – здорово!” автор Панарин Артём, МБОУ “Ижморская ООШ № 2”, Ижморский муниципальный округ

2 место

“Выбор за тобой!” авторы Земзюлина Амалия, Иванова Полина, Березюк Виолетта, МБОУ “Лицей 89”, г. Кемерово

3 место

«Переходи на сторону ЗОЖ! Я научу!» автор Кожевникова Вероника, МБОУ “ООШ № 18”, Калтанский городской округ

3 место

«Стиль жизни – здоровье!» авторы Комиссарова Мария, Смаилов Владислав, Антышев Данил, Куковина Елена, Сулейманов Расим, МБОУ «СОШ №14», Новокузнецкий городской округ

13-18 лет

1 место

“ЗОЖ по-нашему!” авторы Борисенкина Юлия, Десюкова Екатерина, Мещеряков Дмитрий, Проненко Егор, Уткина Полина, Файрузова Альбина, Чарина Ангелина, Швагерус Кристина, ГВО “Феникс”, Киселевский городской округ

2 место

«Раскрась свою жизнь сам!» авторы Артемова Виктория, Мамайкина Юлия, МБОУ «СОШ №13», Новокузнецкий городской округ

2 место

“Четыре простых шага” авторы Балашова Арина, Ванчугова Софья, Григорьева Мария, Данилова Екатерина, Живолуп Алина, Золотарева Софья, Кастаракова Анастасия, Климова Снежана, Нохратский Иван, Попкович Илья, МБОО ДО ЦТР и ГО им. Г. Неунывахина, Мысковский городской округ

3 место

«Действуй!» авторы Баландин Роман, Мамонтова Софья, Петренко Оксана, Анучина Елизавета, МБОУ “СОШ № 1”, Калтанский городской округ

3 место

«Жизнь дана тебе одна» автор Кожакарова Алена, МБОУ «СОШ №11», Киселевский городской округ

 

в номинации “Наглядный раздаточный материал по пропаганде здорового и безопасного образа жизни, направленный на профилактику зависимого поведения обучающихся”

 

8-12 лет

1 место

“Здоровье – вершина, на которую каждый должен забраться сам!” авторы Мишин Леонид, Закиров Артем, Доровских Диана, Колыхаева Софья, Курочкина Алена, ГВО “Хочу быть добровольцем”, Новокузнецкий городской округ

2 место

«Мобильная зависимость учащихся» автор Гатов Егор, МБУ ДО СЮТ, Осинниковский городской округ

3 место

«Наше здоровье в наших руках!» автор Петров Владимир, МКОУ Детский дом №1, г. Гурьевский муниципальный округ

13-18 лет

1 место

“Не выбрасывай детали!” автор Вышегородцева Дарья, ДОО “Импульс”, Киселёвский городской округ

2 место

“О принципах здорового питания” авторы Ананина Полина, Проскурина Мария, МБОУ “СОШ № 44”, Полысаевский городской округ

2 место

«Правила здоровья, или Незабудка здорового образа жизни» автор Нейбергер Ульяна, МБОУ “Ижморская СОШ № 1” Ижморский муниципальный округ

3 место

«Дай себе шанс на счастливую жизнь. Сделай правильный выбор» авторы Берестова Мария, Курочкина Марина, Весельев Илья, Квасова Екатерина, ГВО “Хочу быть добровольцем”, Новокузнецкий городской округ

3 место

«Здоровье не купишь – его разум дарит!» автор Лыткин Илья, МБУ ДО СЮТ,  Осинниковский городской округ

 

Работы победителей регионального этапа (занявшие 1 место) направляются для участия на федеральном этапе Всероссийского конкурса социальной рекламы в области формирования культуры здорового и безопасного образа жизни «Стиль жизни – здоровье! -2020». Итоги будут подведены до 30 ноября 2020 года.

Победители и лауреаты Конкурса награждаются дипломами министерства образования и науки Кузбасса (электронный вариант будет выслан на указанную почту в заявке конкурса).

Все участники Конкурса получают электронный «Сертификат участника». Ссылка для скачивания сертификатов будет размещена после 13 ноября 2020 г. на нашем сайте в данной новости.

Сертификаты

Вызов принят: выйдет ли на российский рынок такси новый игрок | Статьи

Американский агрегатор такси Lyft зарегистрировал в России товарный знак. Это может говорить о планах компании вскоре выйти на новый рынок, считают некоторые опрошенные «Известиями» эксперты. Впрочем, юридическое лицо в России пока не зарегистрировано, обращают внимание другие. Если агрегатор всё же заработает в нашей стране, то его появление может изменить баланс как в конкретных городах, так и на рынке в целом, считают специалисты.

Агрегатор подал знак

В реестре российских товарных знаков на сайте Федерального института промышленной собственности (ФИПС) появилась информация о регистрации товарного знака Lyft. Агрегатор подал заявку 27 января 2020 года, а 25 июня она была одобрена. Товарный знак зарегистрирован в нескольких категориях Международной классификации товаров и услуг (МКТУ). Это в том числе «загружаемое программное обеспечение для использования в координации транспортных услуг» и «транспортные средства».

Lyft — это американский сервис такси. Это второй после Uber игрок на рынке США. На долю Lyft в Штатах приходится 29% поездок, оформленных через сервисы райдшеринга (совместное использование частного автомобиля с помощью онлайн-сервисов поиска попутчиков. К ним себя относят и Uber, и Lyft), а на долю Uber — остальные 71%, свидетельствуют данные американских аналитиков по итогам сентября. Основа бизнес-модели обеих компаний — привлечение водителей со своим транспортом как индивидуальных предпринимателей.

В качестве лица для переписки на сайте ФИПС указан партнер международной юридической фирмы Gowlings WLG и президент Палаты патентных поверенных РФ Александр Христофоров. В разговоре с «Известиями» он подтвердил, что подавал обсуждаемую заявку.

Фото: Global Look Press/Valentin Wolf/imagebroker

— Безусловно, это (регистрация товарного знака. — «Известия») говорит о заинтересованности компании в российском рынке, — сказал Александр Христофоров.

Также процедура нужна для защиты товарного знака от использования другими компаниями и «подготовки почвы для дальнейшего вхождения на рынок», сказал он. О конкретных планах компании по запуску в России эксперту ничего не известно.

Lyft на запрос издания не ответил. Однако при загрузке официального сайта компании из России ресурс автоматически переключается на русский язык. Родной язык пользователи рунета могут увидеть во многих разделах, но самый главный — поездки — не переведен. Мобильное приложение на Android и на iOS тоже работает на английском.

Регистрация товарного знака не обязательно связана с планами по выходу компании на рынок какой-либо страны, считает руководитель центра компетенций Международного евразийского форума такси Станислав Швагерус.

Как правило, о серьезности намерений говорит регистрация юридического лица в России, участие представителей компании в профильных мероприятиях — форумах, конференциях участников рынка, — сказал эксперт.

Ни того, ни другого за Lyft замечено не было, добавил он.

В ожидании

Интерес компаний вроде Didi (китайская компания, предоставляющая в том числе услуги такси, аренды авто, райдшеринга) и Lyft — показатель большого потенциала российского рынка такси, считают в ГК «Везет». В том числе и регионального, где сервисы заказа легковых автомобилей становятся альтернативой общественному транспорту, сказали там.

Фото: Global Look Press/Bryan Smith/ZUMAPRESS

— Выход на новый рынок подразумевает большие бюджеты. Поэтому приоритеты Lyft будут сосредоточены на том, чтобы завоевать на нем свою долю. Этот процесс может изменить баланс условий как в конкретном городе, так и на рынке в целом. Мы, безусловно, будем внимательно следить за деятельностью нового игрока, — заявила представитель пресс-службы «Везет» Юлия Варламова.

Конкуренция на рынке способствует развитию всей таксомоторной отрасли, сказали в «Ситимобил». Однако модели работы сервисов вроде Lyft в США и в России отличаются, обратили внимание в компании.

— В России в крупных городах водители преимущественно берут автомобили в аренду у таксопарков, а не используют свои личные — такая модель распространена в США, основном рынке работы Lyft, — объяснили в «Ситимобил».

В «Яндекс.Такси» и BlaBlaCar воздержались от комментариев.

Трудности перевода

Lyft, как и Uber, называет себя райдшерингом. Для клиента между таким сервисом и такси большой разницы нет — в любом случае машина приедет вовремя и отвезет куда надо. Но «под капотом» эти бизнесы сильно отличаются. Например, традиционное такси подразумевает наличие таксопарка и команды трудоустроенных водителей. Райдшерингу же не обязательно иметь свои автомобили. Эти сервисы позволяют любому человеку с машиной зарегистрироваться в мобильном приложении, став таксистом.

Изначально под райдшерингом подразумевались обоюдно выгодные поездки. Пассажир открывал приложение, указывал пункт назначения, а алгоритм искал водителя, которому было бы удобно подвезти клиента. Но отношение к этой бизнес-модели быстро изменилось. Сегодня шоферы не идут в Uber или Lyft с мыслью просто подвезти кого-то. Они регистрируются в этих сервисах, чтобы работать таксистами.

Фото: ИЗВЕСТИЯ/Павел Бедняков

В России же аналоги Uber и Lyft вроде «Яндекс.Такси» и «Ситимобил» принято называть агрегаторами такси. Хотя эти компании тоже позволяют водителю с авто подключиться к системе распределения заказов, чаще они полагаются на партнерство с таксопарками.

Райдшерингом же в России изначально назывались компании вроде BlaBlaCar. Такие сервисы действительно предлагают пассажирам и водителям совместные поездки типа «автостоп». Однако в последнее время, чтобы избежать путаницы, BlaBlaCar всё чаще предпочитает именовать себя карпулингом.

Особенности национальной езды

Одной из главных трудностей для нового сервиса может стать перенасыщенность рынка в крупных городах, говорят эксперты. Неотъемлемой частью старта для Lyft должен стать демпинг (снижение цен для вытеснения конкурентов), считает главный редактор «Бюро Икс», эксперт по вопросам городского транспорта и инфраструктуры Роберт Ян. Причем занижать цены нужно долго, чтобы к новичку привыкли и клиенты, и водители, полагает он. Однако такая стратегия потребует больших денежных вливаний, что может стать проблемой.

— Агрегатору необходим стратегический партнер или мощный инвестор в России. Я о таких не знаю, но могу предположить, что компания в поисках такого компаньона, — рассуждает эксперт.

Фото: Global Look Press/Randy Pench/ZUMAPRESS

Пока кроме США Lyft работает только в Канаде, обратил внимание Роберт Ян. Но и там сервис доступен не во всех городах.

В России же действуют нетипичные правила для агрегаторов, отметил эксперт. Так, в столичном регионе они обязаны передавать в ЦОДД (Центр организации дорожного движения) правительства Москвы данные об автомобилях и водителях. В конце года будет введен в промышленную эксплуатацию «Цифровой профиль водителя такси».

Поэтому Lyft логичнее заходить в Россию через регионы, считает Роберт Ян. Удачным решением может быть покупка местного игрока, который хорошо представлен за пределами Москвы и Санкт-Петербурга, полагает он.

Новичкам не везет

Впрочем, стратегия по интеграции в регионы может оказаться выигрышной лишь отчасти. В этом году зайти в Россию, минуя столицы, попытался китайский агрегатор Didi. В августе сервис запустился в Казани, а до конца года пообещал появиться в Москве и Санкт-Петербурге.

Однако конкуренты утверждают, что дела у китайцев идут неважно.

Китайское такси Didi в Казани

Фото: РИА Новости/Максим Богодвид

— Мы видим, что водители не проявляют большого интереса к этому игроку (по крайней мере мы не заметили оттока среди наших партнеров), поскольку заявленная Didi низкая комиссия уже сейчас значительно выше, — рассказали в пресс-службе «Ситимобил».

Также в компании не заметили критических изменений в спросе на поездки в Казани.

Didi на момент публикации материала комментарий не предоставил.

Справка «Известий»

Агрегаторы занимают около 60% легального рынка такси в России, показало исследование аналитического центра при правительстве РФ с данными на октябрь прошлого года. Лидером рынка тогда было «Яндекс.Такси» — сервис выполнял 27% всех заказов. На втором месте — «Везет» с 12%. На третьей строчке — «Максим» с долей 9%. Дальше шли Gett и «Ситимобил» с показателями 5 и 1% соответственно. Остальные агрегаторы делят между собой 6% рынка.

Контакты

Административно-хозяйственная часть

Должность

Ф.И.О.

телефон

e-mail

Директор

Олексин
Виктория Николаевна

8(3463)

225-566

  

[email protected]
[email protected]

Документовед (приемная)

Гомон
Елена Петровна

т/ф.  8(3463)

225-570

[email protected]
[email protected]

Заместитель директора

Дрягина
Анжелика Николаевна

8(3463)

278-190

[email protected]

Заместитель директора

Ремезова
Валентина Владимировна

8(3463)

276-857

[email protected]                     

Юрисконсульт

Яндулова Марина Рахмановна

8(3463)

223-656

[email protected]

 

Специалист по кадрам

   

Бебнева Алена Анатольевна 

     

8(3463)

222-799

     

[email protected]

 


Главный бухгалтер


Файзуллина Айгуль Алямовна

 

 

8(3463)

222-674







[email protected]




Экономист

Овсянникова
Лидия Ильинична

Специалист по закупкам

Шамсутдинова
Эльвира Фатовна

8(3463)

223-656

Заместитель главного бухгалтера
        

Хадеева
Наталья Германовна

 

 

 

 

8(3463)

222-887

Бухгалтер

Сайфутдинова Альбина Ирековна

Бухгалтер

Мусина Олеся Манзуровна

Заведующий хозяйством

Созонова Марина Николаевна

8(3463)

222-704

[email protected]

Специалист по охране труда

Энгере
Наталья Викторовна

8(3463)

277-403

[email protected]

Кастелянша

Лубинская
Нели Ивановна

8(3463)

228-641

Охрана

6 мкр, 63 д.

8(3463)

278-111

 

Отделение информационно-аналитической работы

Заведующий отделением

Казарина Эльмира Наильевна 

 

8(3463)

201-171

[email protected]

Методист

Бакулина Нина Борисовна

[email protected]

 Инженер АСУ

Елисеев Добрыня Александрович

8(3463)

 201- 401

[email protected]

Отделение социального сопровождения граждан 
           (сектор первичного приема  оказания срочных услуг (в т.ч. мобильная социальная служба, служба “Социальный патруль”, пункт проката технических средств реабилитации))

Заведующий отделением

Шиханихина Светлана Владимировна

8(3463)

274-713

 

 [email protected]

 

Заместитель заведующего отделением

Охранова Маргарита Николаевна

8(3463)

271-240

Юрисконсульт

Колычева Наталья Викторовна

8(3463)

272-522

[email protected]

 

Психолог

Шевелева Оксана Викторовна

 

8(3463)

272-991

 

 

[email protected]

 

Психолог

Реет Тамара Александровна

Участковая социальная служба (20 социальных участков, в том числе «дворовый социальный менеджмент»)

Специалист по работе с семьей

Кондинкина Ксения Алексеевна

8(3463)

271-400

 

 

 

 

 

 

 

 

[email protected]

 

Специалист по работе с семьей

Донченко Рита Михайловна

8(3463)

229-386

 

Специалист по работе с семьей

Петкевич Анастасия Вадимовна

 

 

 

8(3463)

271-400

 

Специалист по работе с семьей

Полянская Татьяна Вальтеровна

Специалист по работе с семьей

Кремнева Елена Андреевна

8(3463)

273-582

 

Специалист по работе с семьей

Бочкарева Ирина Викторовна

8(3463)

273-581

Специалист по работе с семьей

Агапова Юлия Викторовна

8(3463)

273-579

Специалист по работе с семьей

Шаригина Алиса Амировна

8(3463)

272-557

Специалист по работе с семьей

Ярополова Юлия Александровна

8(3463)

273-579

 

 

 

 

 

 

 

[email protected]

 

Специалист по работе с семьей

Петрова Людмила Анатольевна

8(3463)

27-35-82

Специалист по работе с семьей

Драганчук Надежда Витальевна

8(3463)

273-579

Специалист по работе с семьей

Пастух Наталья Викторовна

8(3463)

272-557

Специалист по работе с семьей

Курманова Розалия Мансуровна

 

 

8(3463)

273-581

Специалист по работе с семьей

Родченкова Татьяна Владимировна

Специалист по работе с семьей

Блощицына Любовь Владимировна

8(3463)

272-557

Специалист по работе с семьей

Сайфуллина Диана Мавлудовна

8(3463)

273-581

Специалист по работе с семьей

Аймашева Айгуль Фиадисовна

 

8(3463)

223-824

Специалист по работе с семьей

Окулова Елена Александровна

 

8(3463)

272-991

Специалист по работе с семьей

Шарафутдинова Диана Радиковна

Специалист по работе с семьей

Балышева Юлия Ивановна

8(3463)

229-386

Специалист по работе с семьей

Придатько Ольга Павловна

8(3463)

273-581

Специалист по работе с семьей

Журавлева Елена Александровна

 

8(3463)

273-579

Специалист по работе с семьей

Шкредова Юлия Игоревна

Сектор первичного приема оказания срочных услуг (в том числе 1 мобильная служба, служба «Социальный патруль», пункт проката технических средств реабилитации)

Специалист по работе с семьей

Скуратова Наталья Геннадьевна

8(3463)

272-991

[email protected]

  

Специалист по работе с семьей

Кривенская Галина Станиславовна

8(3463)

271-400

Сектор сопровождения социальных контрактов (в том числе содействие гражданам в признании нуждающимся в социальном обслуживании и социальном сопровождении)

Специалист по социальной работе

Овчинникова Оксана Васильевна

 

 8(3463)

22-96-89

 

[email protected]

Специалист по социальной работе

Кузьмина Марина Владимировна 

[email protected]

 

Специалист по работе с семьей

Маркова Алена Андреевна

 

8(3463)

272-991

 

[email protected]

 

Специалист по работе с семьей

Хуснетдинова Гульнара Закировна

Специалист по работе с семьей

Юрченко Ольга Анатольевна

 

8(3463)

273-582

Специалист по работе с семьей

Светличная Светлана Александровна

Специалист по работе с семьей

Куренкова Татьяна Сергеевна

8(3463)

273-579

Социально-медицинское отделение

Заведующий отделением

Шаршебаев Докдурбай Чолумканович

8(3463)

276-857

[email protected]

Медицинская сестра

Адылова Галина Николаевна

 

[email protected]

 

Врач-специалист

Артамонова Ирина Николаевна

 

Специализированное отделение социально-медицинского обслуживания на дому граждан пожилого возраста и инвалидов

Заведующий отделением

Якимова Екатерина Геннадьевна

8(3463)

22-36-59

 

[email protected]

Специалист по работе с семьей

Гасымова Варвара Витальевна

8(3463)

22-35-94

 

[email protected]

 

Отделение социальной реабилитации и абилитации (в том числе сектор реабилитации инвалидов трудоспособного возраста , сектор дневного пребывания, «Университет третьего возраста»)

Заведующий отделением

Зайцева Альбина Владимировна

 

8(3463)

223-852

[email protected]

Культорганизатор

Куриенко Лариса Валерьевна

[email protected]

Специалист по комплексной реабилитации

Бердюгина Любовь Геннадьевна

8(3463)

223-604

[email protected]

Инструктор по труду

Березовская Лариса Ивановна

8(3463)

223-852

 

Отделение «Специальный дом для одиноких престарелых» (в том числе сектор сопровождения граждан пожилого возраста и инвалидов)

Заведующий отделением

Сырятова Тагзимя Шагитовна

8(3463)

221-081

[email protected]

[email protected]

 

Специалист по работе с семьей

Батагова

Елена Владимировна

 

8(3463)

276-585

[email protected]

Администратор

 

8(3463)

221-737

[email protected]

Охрана

11 мкр, 123 д.

8(3463)

223-063

 

Отделение психологической помощи гражданам (в том числе служба профилактики семейного неблагополучия, служба «Экстренная детская помощь»)

Заведующий отделением

Горбунова Светлана Александровна

8(3463)

222-886

 

[email protected]

Специалист по работе с семьей

Шангареева Регина Рамзиловна

8(3463)

273-582

Кулакова Ирина Михайловна

8(3463)

271-925

Швагерус Елена Иосифовна

8(3463)

273-582

Назарян Екатерина Васильевна

 

8(3463)

271-925

Сиразетдинова Эльвира Каюмовна

Юрисконсульт

Васильева Наталья Владимировна

8(3463)

223-656

[email protected]

Психолог

Безуглова Светлана Федоровна

8(3463)

273-582

[email protected]

Яхина Лилия Гафуровна

 

Психолог

Хамбелова Ирина Ивановна

 

Отделение экстренной психологической помощи

Заведующий отделением

Щеколдина Олеся Юрьевна

8(3463)

228-314


[email protected]

Отделение для несовершеннолетних

(в том числе «Социальный приют»)

Заведующий отделением


Потапова Лариса Хамитовна

 

 

 

 

8(3463)

220-849

 

 

 [email protected]

Специалист по работе с семьей

Альмухаметова Альбина Адибовна

Психолог

Мальмина Светлана Евгеньевна

8(3463)

225-212

Юлия Жумина, Казахстан

Личная информация

Деятельность

скрыта или не указана

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Интересы

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимая музыка

скрыта или не указана

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые фильмы

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые телешоу

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые книги

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые игры

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые цитаты

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


О себе

скрыто или не указано

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Клеточная линия NCl-h541 является полезной моделью in vitro для исследований транспорта дистального эпителиального барьера легких человека

Отсутствие хорошо охарактеризованной, непрерывно развивающейся in vitro модели фенотипа эпителия дистального отдела легких человека представляет собой серьезное ограничение в области ингаляционной биофармацевтики, особенно в контексте исследований трансэпителиального транспорта. Здесь мы исследовали, может ли линия клеток аденокарциномы легкого человека, NCl-h541, служить моделью in vitro дистального эпителия легкого человека.Развитие барьерных свойств изучали с помощью иммуноцитохимии (ICC) против белков соединения zonula occludens, белка 1 (ZO-1) и E-кадгерина, а также измерения трансэпителиального электрического сопротивления (TEER). Кроме того, были проведены исследования транспорта с параклеточными маркерными соединениями флуоресцеин натрия и флуоресцеинизотиоцианатом (FITC)-меченными декстранами с молекулярной массой в диапазоне от 4 до 70 кДа. Экспрессию P-гликопротеина (P-gp; ABCB1) и переносчиков органических катионов (OCT / Ns; SLC22A1-A5) исследовали с помощью ICC и иммуноблоттинга.Функцию P-gp оценивали с помощью исследований высвобождения монослоя и двунаправленного транспорта с использованием родамина 123 (Rh223) и ингибиторов верапамила и LY335979. Поглощение 4- (4- (диметиламино) стирил) -N-метилпиридиния иодида (ASP (+)) измеряли для оценки функции переносчика органических катионов in vitro. Кроме того, был изучен ингибирующий потенциал некоторых органических катионов на поглощение ASP (+). Клетки NCl-h541 при выращивании в условиях, покрытых жидкостью, через 8-12 дней культивирования образовывали сливные, электрически непроницаемые монослои с пиковыми значениями TEER приблизительно 1000 Ом · см (2).Эти монослои были способны дифференцировать субстраты, транспортируемые через клетки, в соответствии с их молекулярной массой. Присутствие P-gp, OCT1, OCT2, OCT3, OCTN1 и OCTN2 было подтверждено Вестерн-блоттингом и ICC и было аналогично данным для свежевыделенных человеческих альвеолярных эпителиальных клеток в первичной культуре. Высвобождение Rh223 из монослоев NCI-h541 зависело от времени и демонстрировало низкое, хотя и значительное ослабление обоими ингибиторами. В исследованиях транспорта Rh223 проявлял чистую секрецию, которая снова подавлялась добросовестными модуляторами P-gp.Поглощение ASP (+) зависело от времени и температуры с Km = 881,2 ± 195,3 мкМ и Vmax = 2,07 ± 0,26 нмоль / мин / мг белка. ТЕА, амантадин, хинидин и верапамил значительно ингибировали захват ASP (+) клетками NCl-h541, тогда как эффект d- и l-карнитина и эрготионеина, двух субстратов OCTN, был менее выражен. Клетки NCl-h541 представляют собой первую линию клеток эпителиального происхождения дистальных отделов легких человека, способную образовывать монослои с заметными барьерными свойствами. Более того, экспрессия и активность переносчика лекарств в клетках NCl-h541 соответствовала тому, что было описано для альвеолярных эпителиальных клеток человека в первичной культуре.

Ключевые слова: Р-гликопротеин; абсорбция; перевозчики наркотиков; ингаляционная биофармацевтика; переносчики органических катионов; легочная утилизация лекарств.

Введение

Введение

Во время прогрессирования рака раковые клетки вырабатывают различные стратегии, с помощью которых они избегают атаки иммунной системы и ослабляют ее [1]. Таким образом, основными принципами современной иммунной терапии являются нацеливание на регуляторные / иммуносупрессивные механизмы и индукция / восстановление иммунитета против рака [2–4].Вакцинация от рака направлена ​​на повышение чувствительности иммунной системы пациента к распознаванию опухолеспецифических антигенов de novo или усиление ранее существовавших иммунных ответов с конечной целью вызвать долгосрочные опухолеспецифические ответы Т-лимфоцитов CD8 + [2, 5, 6]. В этом контексте терапевтическая эффективность в значительной степени зависит от достаточной и правильной презентации раковых антигенов на основных комплексах гистосовместимости (MHC) -I и -II антигенпрезентирующими клетками (APC), чтобы вызвать активацию и эффекторную функцию опухолево-реактивных CD8 + и CD4 + Т-лимфоциты [6, 7].Дендритные клетки (ДК) считаются наиболее мощными АРС для индукции (раковых) антиген-специфических ответов CD8 + Т-клеток [8]. Многие исследования уже продемонстрировали, что введение в ДК ограниченных по MHC-I пептидов опухолевого происхождения или лизатов цельных опухолевых клеток приводит к индукции опосредованных CD8 + Т-клетками противораковых реакций in vitro и in vivo [7]. ДК могут проявлять разные фенотипы в зависимости от условий окружающей среды. Следовательно, в ответ на специфические факторы ДК созревают и, таким образом, становятся способными опосредовать примирование и активацию Т-клеток.В этом контексте было показано, что адъювантный компонент вакцин является критическим детерминантом в запуске созревания DC [9]. Были изучены различные стратегии для оптимизации презентации антигена DC, например Выделение DC в сочетании с импульсным использованием антигена ex vivo или вакцинацией in vivo [10].

Было показано, что составление антигенов в виде биосовместимых систем доставки значительно увеличивает биодоступность антигенов, а также их захват и обработку DC, что приводит к улучшению противоракового ответа [11–16].Хитозан представляет собой полисахарид (деацетилированный хитин), полученный в основном из ракообразных, и проявляет адъювантные / провоспалительные свойства, благодаря которым он способен вызывать врожденный иммунный ответ [17]. В контексте антиген-специфических иммунных ответов хитозан проявляет адъювантную активность и, как таковой, представляет собой интересный биополимер для использования в условиях вакцинации против опухолей [18, 19]. Предпосылки для его адъювантной активности до сих пор полностью не изучены, и результаты неубедительны в отношении влияния молекулярной массы и степени деацетилирования (DDA) на его адъювантную активность.Поскольку предыдущие исследования показали преимущество хитозана с 90% DDA по сравнению с другими DDA, это качество также использовалось в настоящем исследовании [20].

Более того, хитозан уже был описан как подходящая система доставки для вакцинации [12–16, 21–24], а наночастицы хитозана (CNP) уже использовались для улучшения противоопухолевых ответов [25–27]. Первые подходы к использованию CNP в качестве сотовой системы доставки, например химиотерапевтические препараты также были протестированы на доклинических моделях протоковой аденокарциномы поджелудочной железы (PDAC) с обнадеживающими результатами [28, 29].Наночастицы хитозана могут быть перенесены в иммунокомпетентные клетки различными путями, в том числе через слизистую оболочку. Это очень многообещающий подход, особенно если необходим интенсивный цитотоксический иммунный ответ, как в случае противоопухолевой вакцинации, поскольку иммунная система слизистой оболочки стимулирует клеточный иммунный ответ по сравнению с гуморальными эффектами. Еще одно преимущество использования слизистых оболочек – это неинвазивное применение (по сравнению с инъекциями). Действительно, CNP могут быть доставлены в слизистую оболочку дыхательных путей путем пероральной ингаляции или назального введения, если они составлены в виде лекарственного препарата с правильными характеристиками [25].В этом исследовании CNP были стабилизированы в матрице сухого порошка маннита путем распылительной сушки для повышения стабильности при хранении. Регулируя размер частиц такого продукта, можно облегчить доставку в легкие (аэродинамический размер частиц менее 5 мкм) или отложение в носу (размер частиц> 10 мкм).

PDAC является 4-й по частоте причиной смертей, связанных с раком, в западных странах и по-прежнему имеет низкий общий коэффициент 5-летней выживаемости ниже 10%. Из-за отсутствия надежных тестов для раннего выявления и специфических симптомов заболевания, PDAC обычно диагностируется на поздней стадии [30, 31].Более того, на сегодняшний день отсутствуют эффективные терапевтические возможности для лечения пациентов с поздними стадиями PDAC, что связано с высокой устойчивостью опухоли к любой доступной классической или таргетной терапии [31–33]. Одним из факторов, способствующих этой широкой терапевтической резистентности, является выраженная строма опухоли, которая демонстрирует исключительную внутри- и межопухолевую гетерогенность в отношении численности и распределения различных популяций иммунных клеток [33–35]. В отличие от других опухолевых образований, таких как меланома, PDAC считается малоиммуногенной опухолью из-за его низкой мутационной нагрузки [36–38].Таким образом, эффективная стратегия доставки антигена, ведущая к эффективной презентации антигена DC и активации специфических клонов CD8 + Т-клеток, представляет собой многообещающую терапевтическую стратегию для индукции мощного и длительного PDAC-направленного иммунитета, в конечном итоге ведущего к устранению или, по крайней мере, контролю опухолевой нагрузки. .

Используя производный овальбумина пептид SIINFEKL (OVA 257–264) в качестве модельного антигена, целью этого исследования было изучить всесторонний подход in vitro к потенциалу CNP различного размера и качества как системы доставки антигена индуцировать правильная активация антиген-специфических CD8 + Т-клеток с помощью ДК и последующий опосредованный Т-клетками лизис опухолевых клеток.

Материалы и методы Получение и характеристика CNP

Наночастицы хитозана были получены ионным гелеобразованием с использованием хитозана различного качества (Chitoscience 90/10 (# 23601), Chitoscience 90/20 (# 23602) и Chitoscience 90/50 (# 23603), все от Heppe Biomedical). , Галле, Германия) с DDA 90% и различной молекулярной массой (выраженной как вязкость 2% раствора в уксусной кислоте, равная 10, 20 и 50 мПа · с). Качество зашифровано в соответствующем имени X / Y, где X означает DDA, а Y – соответствующую вязкость.Хитозан был помечен FITC (# F7-250-1G, Sigma-Aldrich Chemie GmbH, Мюнхен, Германия), что позволяет обнаруживать частицы в соответствии с описанной процедурой [39]. Кармеллоза-натрий (CMC # C5678-500G, Sigma-Aldrich Chemie GmbH, Мюнхен, Германия) использовали в качестве противоионного полимера [40]. Хитозан растворяли в 1% уксусной кислоте, получая 0,1% раствор по массе. КМЦ растворяли в воде, также получая 0,1% раствор по массе. Затем раствор КМЦ добавляли к раствору хитозана при постоянном перемешивании при комнатной температуре (КТ), что вызывало спонтанную самосборку в наночастицы.После этого дисперсию хранили в холодильнике (2–8 ° C) не менее 3 часов для облегчения затвердевания наночастиц перед отмывкой центрифугированием. Наночастицы снова ресуспендировали до концентрации 0,1% масс. В 1% уксусной кислоте перед добавлением 2% маннита (№ 450001D, Roquette, Франция). Препарат сушили распылением в Mini Spray Dryer B-290, лабораторной распылительной сушилке (Büchi, Flawil, Швейцария), используя двухжидкостное сопло диаметром 1,5 мм. Расход распыляемого газа поддерживался постоянным на уровне 472 л / час, а объемный расход – на уровне 35 м³ / час.Температура на входе была установлена ​​на 80 ° C, а скорость подачи была отрегулирована для достижения температуры на выходе ниже 40 ° C (оптимальная: 35 ° C). Размер частиц дисперсии наночастиц определяли методом динамического рассеяния света (ZetaSizer, Малверн, Великобритания). Используемые CNP и их свойства перечислены в таблице 1.

10.1371 / journal.pone.0239369.t001 Таблица 1 Размеры CNP после приготовления и очистки наночастиц (z-Average – средний размер частиц, индекс полидисперсности (PDI) – мера ширины распределения).
CNP (с FITC-конъюгацией) z-Среднее (в нм) PDI
90/10 220 <0,17
90/20 384 0,22
90/50 706 0,39
90/10-OVA 201 0,14
90/20-OVA 321 0.15
90/10-SIINFEKL (без FITC-конъюгации) 211 0,15
Клеточные линии и культура клеток

Клетки DC2.4 представляют собой иммортализованные мышиные DC, полученные от мышей C57BL / 6, которые обладают способностью представлять антигены на MHC I, сравнимую с человеческими DC [41]. Ячейки DC2.4 – это добрый подарок от К.Л. Рок, Институт рака Дана-Фарбер, Инк., Бостон, Массачусетс. h541 – это иммортализованная клеточная линия, полученная из аденокарциномы папиллярного легкого человека, используемая в качестве модели эпителия легкого [42].Клеточная линия была любезно подарена профессором доктором Сабиной Фукс из отделения травматологической и ортопедической хирургии, экспериментальной травматологической хирургии, Университетский медицинский центр Шлезвиг-Гольштейн, Киль, Германия. Клетки Panc02 представляют собой злокачественные эпителиальные клетки протоков поджелудочной железы мышей, происходящие от мышей C57BL / 6 [43, 44], а клетки Panc-OVA, сверхэкспрессирующие SIINFEKL, происходят из клеток Panc02. Обе клеточные линии были любезно пожертвованы доктором Кристианом Бауэром, Отделение гастроэнтерологии, эндокринологии, инфектиологии и метаболизма, Университетская клиника Гиссена и Марбурга, Марбургский кампус, Марбургский университет Филиппа, Германия.Клеточные линии культивировали в среде RPMI 1640 (# R04-17500 с добавлением 10% FCS (# P30-1506, оба PAN-Biotech, Aidenbach, Германия), 2 мМ L-глутамина (# P04-80100, PAN-Biotech, Aidenbach). , Германия) и 1% Pen / Strep (№ 15140–122, Gibco через Thermo Fisher Scientific, Schwerte, Германия). Для клеток DC2.4: 1% минимум незаменимых незаменимых аминокислот в среде (№ P08-32100, PAN- Biotech, Aidenbach, Germany) Для клеток Panc-OVA в среду дополнительно добавляли 0,5 мг / мл сульфата G418 (# A1720, Sigma-Aldrich Chemie, Мюнхен, Германия).Все клетки обычно культивировали при 37 ° C, 5% CO 2 и относительной влажности 85%. Регулярно проверяли отсутствие микоплазм в культурах клеток. Линии мышиных клеток (DC2.4, Panc02 и Panc-OVA) проверяли с использованием штрих-кодирования ДНК с помощью ПЦР-амплификации 5′-кодирующей области цитохром с оксидазы I. Клетки h541 человека проверяли с помощью анализа коротких тандемных повторов.

Выделение моноцитов и создание человеческих антигенпрезентирующих клеток

Для создания человеческих APC (M1- и M2-макрофагов, DC) in vitro моноциты выделяли из систем, удерживающих лимфоциты, истощенные тромбоцитами человека, путем центрифугирования в градиенте плотности с последующим центрифугированием в противотоке в соответствии с установленные протоколы [45, 46].Использовалась только кровь здоровых доноров, и от всех доноров было получено письменное информированное согласие. Одобрение было получено этическим комитетом медицинского факультета Кильского университета (номер ссылки: D490 / 17). Для дифференциации использовали только моноциты с чистотой не менее 90%. Для дифференцировки в M1- или M2-макрофаги изолированные моноциты культивировали в среде RPMI 1640 с добавлением 1% FCS, 2 мМ L-глутамина, 1% Pen / Strep и 2,4 нг / мл GM-CSF (240 Ед / мл, # 572905) или 50 нг / мл M-CSF (100 Ед / мл, # 574806, оба Biolegend, Fell, Германия).Успешную поляризацию моноцитов в M1- и M2-макрофаги оценивали с помощью проточной цитометрии и анализа количественной ПЦР (S1 Фиг.). После 7 дней культивирования дифференцировки в мешках VueLife (# 3300, CellGenix, Фрайбург-им-Брайсгау, Германия) макрофаги собирали и использовали для экспериментов. Для генерации ДК [47] изолированные моноциты ресуспендировали в среде RPMI 1640 с добавлением 10% FCS, 2 мМ L-глутамина и 1% Pen / Strep, а затем высевали в 12-луночные планшеты с плоским дном с 1 x 10 6. клеток / мл на лунку.После присоединения клетки стимулировали 250 ед / мл IL-4 (# 574004) и 800 ед / мл GM-CSF (# 572905, оба Biolegend, Fell, Германия). Стимуляцию повторяли через 48 часов, и дифференцированные DC использовали для экспериментов через 5 дней стимуляции.

Инкубация антигенпрезентирующих клеток с CNP

Для анализов поглощения / интернализации APC мыши и человека клетки либо оставляли необработанными, либо обрабатывали 100 мкг / мл CNP (90/10; 90/20; 90/50) в течение 24 часов. Для этого мышиный DC2.4 клетки высевали в 12-луночные планшеты с плоским дном из расчета 8 × 10 4 клеток / мл на лунку за 24 часа до стимуляции. Человеческие DC были получены, как описано выше. После замены среды человеческие DC обрабатывали по-разному. M1- и M2-макрофаги также генерировали, как описано выше, и высевали из расчета 2,5 × 10 5 клеток / мл на лунку в 12-луночные планшеты. После соблюдения режима лечения макрофаги лечили по-разному. Перед анализом с помощью проточной цитометрии или визуализирующей цитометрии выживаемость клеток обычно проверяли с использованием системы визуализации основных клеток EVOS XL (AMG, Ботелл, США).Поверхностные маркеры, используемые для характеристики и идентификации различных APC с помощью проточной цитометрии и визуализирующей цитометрии, перечислены в таблице S1.

Совместное культивирование человеческих DC и клеток h541

Выделенные человеческие моноциты высевали в 12-луночные планшеты из расчета 1 × 10 6 клеток / мл на лунку и стимулировали IL-4 и GM-CSF, как описано выше. После 5 дней дифференцировки культуры 1 × 10 5 / мл h541 эпителиальных клеток легких человека добавляли на лунку к (дифференцированным) человеческим DC.Эпителиальный фенотип клеток h541 был обеспечен через 24 часа в сокультуре и были добавлены 100 мкг / мл CNP (90/10; 90/20; 90/50). Анализы интернализации были выполнены визуализирующей цитометрией после 24 часов инкубации CNP. Маркеры поверхности, используемые для характеристики и идентификации различных популяций клеток, перечислены в таблице S1.

Выделение мышиных CD8 + Т-лимфоцитов от мышей OT-1 и совместное культивирование с импульсными антигенами клетками DC2.4

Эксперименты и уход на животных проводились в соответствии с европейскими руководящими принципами по уходу и использованию лабораторных животных и одобрены Министерством энергетики и сельского хозяйства. , Окружающая среда, природа и цифровизация земли Шлезвиг-Гольштейн (номер ссылки 1115).После эвтаназии путем смещения шейки матки селезенки мышей OT-1 удаляли и механически измельчали ​​через сетчатый фильтр для клеток Falcon (размер ячейки 100 мкм, # 352360, Falcon via Thermo Fisher Scientific, Schwerte, Германия). После этого спленоциты промывали ледяным буфером MACS (PBS с добавлением 0,5% BSA, 2 мМ EDTA, pH 7,4, стерильно фильтровали и дегазировали) и суспензию клеток фильтровали через сетчатый фильтр для клеток Falcon (размер ячеек 30 мкм, # 352340, Falcon через Thermo Fisher Scientific, Шверте, Германия).Затем спленоциты центрифугировали в течение 10 мин при 300 мкг и 4 ° C, ресуспендировали в буфере для лизиса эритроцитов (155 мМ NH 4 Cl, 10 мМ KHCO 3 , 0,1 мМ EDTA в бидистиллированной воде, стерильно фильтровали) и инкубировали 6 мин при комнатной температуре в темноте. Затем спленоциты промывали ледяным буфером MACS, центрифугировали в течение 10 минут при 180 x g и 4 ° C, ресуспендировали в ледяном буфере MACS и снова фильтровали через сетчатый фильтр для клеток (размер ячеек 30 мкм). После этого определяли количество клеток и доводили клеточную суспензию до 10 8 клеток / мл.В дальнейшем CD8 + OT-1 Т-лимфоциты выделяли из спленоцитов OT-1 с использованием набора для изоляции Т-клеток MojoSort Mouse CD8 (№ 480011, Biolegend, Fell, Германия) в соответствии с инструкциями производителя. После процесса выделения чистоту CD8 + OT-1 Т-клеток обычно анализировали с помощью проточного цитометрического анализа. Для следующих экспериментов использовали только суспензию Т-клеток CD8 + OT-1 с чистотой> 90%.

Для совместного культивирования CD8 + OT-1 Т-клеток с DC клетки DC2.4 высевали за день до этого в 12-луночные планшеты для культивирования клеток, как описано ранее.Клетки DC2.4 либо оставляли необработанными, либо стимулировали 100 мкг / мл пустых CNP (90/10), 100 мкг / мл загруженных SIINFEKL 90/10-CNP или 1 мкг / мл SIINFEKL (# vac-pova-100 InvivoGen Европа, Тулуза, Франция). Через пять часов клетки DC2.4 отделяли, промывали и затем 7,5 × 10 4 клеток на лунку высевали в 96-луночные планшеты с плоским дном для сокультивирования. Уровни SIINFEKL на клеточной поверхности, связанного с комплексом H-2Kb в дифференцированно обработанных клетках DC2.4, обычно анализировали с помощью проточной цитометрии перед началом сокультивирования с изолированными CD8 + OT-1 Т-клетками.Наконец, 2,5 × 10 5 Т-клеток CD8 + OT-1 добавляли на лунку 96-луночного планшета к клеткам DC2.4, а также 150 нг / мл рекомбинантного мышиного IL-2 (562,5 Ед / мл, # 575404 , Biolegend, Фелл, Германия). Рестимуляцию Т-клеток 150 нг / мл рекомбинантного мышиного IL-2 (562,5 Ед / мл) проводили через 48 часов после начала сокультивирования. Через 72 часа после начала сокультивирования CD8 + OT-1 Т-клетки подвергали подсчету жизнеспособных клеток с использованием метода исключения трипанового синего (# 15250061, Gibco via Thermo Fisher Scientific, Шверте, Германия) и камеры Нойбауэра, проточно-цитометрического анализа активации Т-клеток. маркеры и анализ уничтожения опухолевых клеток.Маркеры поверхности, используемые для характеристики и идентификации различных популяций клеток, перечислены в таблице S1.

Анализы киллинга с CD8 + OT-1 Т-лимфоцитами

Для анализа антиген-специфического лизиса опухолевых клеток, клетки Panc02 и Panc-OVA, соответственно, были засеяны с плотностью 1 x 10 3 клеток на лунку в 96-луночном планшете. тарелка. На следующий день 2,0 x 10 5 CD8 + OT-1 Т-лимфоцитов, которые, как было показано в экспериментах по титрованию, являются разумным числом клеток для этого экспериментального подхода, из различных условий совместного культивирования с DC2.Добавляли по 4 клетки на лунку. Через 24 часа гибель опухолевых клеток поджелудочной железы оценивали с помощью автоматического микроскопа Lionheart FX (BioTek, Бад-Фридрихсхалл, Германия). С этой целью CD8 + OT-1 Т-клетки, а также отделенные клетки Panc02 и Panc-OVA, соответственно, были осторожно аспирированы и в лунки добавлен стерильный предварительно нагретый PBS. Для анализа слияния клеток лунки сканировали при 4-кратном увеличении и изображения сшивали с помощью программного обеспечения анализа данных Gen5 (BioTek, Бад-Фридрихсхалл, Германия), чтобы получить одно изображение всей лунки.Затем с помощью встроенного инструмента «Cellular Analysis» была выбрана типичная квадратная пробка размером 9000 мкм 2 . Наконец, количественная оценка слияния клеток была выполнена с использованием программного обеспечения анализа данных Gen5, которое отличало клеточную область от бесклеточной области на основе полученных сигналов фазового контраста и настройки определенных параметров инструмента «Cellular Analysis» (см. Таблицу 2):

10.1371 / journal.pone.0239369.t002 Таблица 2 Параметры инструмента «Cellular Analysis», используемого для определения слияния клеток.
Параметр Значение
Порог Авто (проверено) = 13
Фон свет
Разделение соприкасающихся предметов проверено
Заполнить отверстия в маске не проверено
Мин. размер объекта 10 мкм
Макс. размер объекта 10.000 мкм
Включить объекты первичной кромки проверено
Анализировать все изображение не проверено
форма штекера = квадрат
размер заглушки = 3.000 мкм x 3.000 мкм
Расширенные параметры обнаружения –
Сглаживание фона проверено
Авто не проверено
Диаметр катящегося шарика 10 мкм
Сила сглаживания изображения 10 циклов
Оценить фон на 0% самых низких пикселей
Первичная маска Использовать пороговую маску

Слияние ячеек в репрезентативной зоне рассчитывалось по следующей формуле: Сотовая связь (%) = Площадь объекта (мкм2) Размер штекера (мкм2) 100

Проточная цитометрия

Оценка дифференцировки клеток, маркеров клонирования и маркеров активации Т-клеток, а также презентации SIINFEKL на клеточной поверхности через H-2Kb Т-клеток OT-1 и различных APC, соответственно, выполнялась с помощью иммунофлуоресцентного окрашивания и последующего проточно-цитометрического анализа (маркеры используемые указаны в таблице S1).Перед иммуноокрашиванием клетки инкубировали в течение 10 минут при 4 ° C в FcR Blocking Reagent (# 130-059-901, Miltenyi Biotec, Bergisch Gladbach, Германия), разведенном в ледяном буфере MACS в соответствии с инструкциями производителя. После этого 2–4 x 10 5 клеток / лунку и окрашивание переносили в 96-луночный планшет с V-образным дном для иммунофлуоресцентного окрашивания. Для фенотипирования DC человека используются анти-HLA-DR-FITC (клон: L243, # 307603), анти-CD80-APC (клон: 2D10, # 305220), анти-CD86-AlexaFluor488 (клон: IT2.2, # 305413) (все Biolegend, Fell, Германия) и анти-PD-L1-PECy7 (клон: MIh2, # 550017) (BD Biosciences, Гейдельберг, Германия). Для характеристики человеческих M1- и M2-макрофагов, анти-CD14-PE (клон: M5E2, № 301806), анти-CD16-FITC (клон: 3G8, № 302006), анти-CD68-APC (клон: Y1 / 82A , # 333810), анти-HLA-DR-FITC (клон: L243, № 307603) (все Biolegend, Fell, Германия) и анти-CD163-PE (клон: REA812, № 130-112-286 от Miltenyi Biotec, Bergisch Гладбах, Германия). Анти-CD25-APC (клон: BC96, № 302610), анти-CD44-FITC (клон: IM7, № 103022), анти-CD69-PE (клон: h2.2F3, # 104508) и анти-CD8a-PE (клон: 53-6.7, # 100722) (все Biolegend, Fell, Германия) использовали для фенотипирования мышиных CD8 + OT-1 Т-клеток. Для оценки H-2Kb-ассоциированной презентации SIINFEKL использовали анти-SIINFEKL-H-2kb-PE (клон: 25-D1.16, # 141604, Biolegend, Fell, Германия). Все антитела разводили ледяным буфером MACS в соответствии с инструкциями производителя и инкубировали в течение 30 минут при 4 ° C в темноте. Специфичность проверяли дополнительным окрашиванием соответствующими контрольными антителами изотипа.Сбор данных выполняли с помощью FACScalibur с использованием программного обеспечения CellQuest Pro (оба – Becton Dickinson, Сан-Хосе, США). Окончательная оценка данных была выполнена с помощью программного обеспечения FlowJo V10.1 (FlowJo LCC, Орегон, США).

Визуализирующая цитометрия

Визуализирующая цитометрия использовалась для определения интернализации CNP. Для окрашивания мембран ДК человека использовали анти-CD11c-APC (клон: S-HCL-3, # 371506), в то время как клетки h541 окрашивали анти-E-кадгерин-AlexaFluor647 (клон: 67A4, № 324112) (оба были приобретены у Biolegend, Фелл, Германия).Мышиные клетки DC2.4 окрашивали анти-CD11c-PE (клон: HL3, # 561044, BD Bioscience, Гейдельберг, Германия). После окрашивания и промывки клетки фиксировали в 50 мкл 1% (об. / Об.) Буферного раствора PFA / MACS. Визуализирующий цитометрический анализ выполняли с помощью проточного цитометра Amnis ImageStream ®X Mk II Imaging (Merck Millipore, Дармштадт, Германия).

Программное обеспечение для анализа изображений IDEAS ® использовалось для определения границ клеток на основе окрашивания мембран (или изображений в светлом поле), чтобы клетки с четким зеленым сигналом внутриклеточной флуоресценции можно было идентифицировать как клетки с интернализованными FITC-конъюгированными CNP, тогда как клетки без внутриклеточной флуоресценции сигнал были идентифицированы как клетки без CNP-интернализации.Долю внутриклеточно окрашенных клеток определяли путем расчета отношения клеток с интернализованными CNP к общему количеству клеток.

Конфокальная лазерная сканирующая микроскопия (CLSM)

Анализ конфокальной лазерной сканирующей микроскопии (CLSM) был использован в качестве другого метода для подтверждения интернализации CNP в DC. Выделенные моноциты высевали на покровные стекла (1 × 10 6 клеток / мл) и дифференцировали в человеческие DC (как описано ранее). После инкубации со 100 мкл / мл FITC-конъюгированных 90/10-CNP в течение 24 часов клетки промывали PBS и фиксировали 400 мкл 4.5% PFA в течение 15 минут при комнатной температуре. После следующих этапов промывки добавляли 500 мкл 4% BSA / PBS и инкубировали в течение 30 минут для блокирования неспецифического связывания иммуноглобулинов. Затем анти-CD11c-APC (клон: S-HCL-3, # 371506, Biolegend, Fell, Германия) для окрашивания мембран ДК и окрашивающий ядро ​​краситель Hoechst # 33258 (# 861405, Sigma-Aldrich, Мюнхен, Германия) разводили (анти-CD11c-APC 1:50, Hoechst 1: 500) в 100 мкл 1% BSA / PBS и клетки инкубировали в течение 60 минут при комнатной температуре в защищенном от света месте.После промывки покровные стекла помещали с реагентом FluorSave (№ 345789, Merck Millipore, Дармштадт, Германия) и переворачивали на предметные стекла. Обзорные изображения при меньшем увеличении (10X, 20X, 40X) были получены с использованием автоматического микроскопа Lionheart FX (BioTek, Бад-Фридрихсхалль, Германия). Изображения с большим увеличением (60X) были получены с использованием CLSM (Carl Zeiss Microscopy GmbH, Йена, Германия).

Анализ активности каспазы-3/7

Активность каспазы-3/7 в первичных DC человека и макрофагах определяли с использованием анализа Caspase-3/7 Glo (# G8092, Promega, Mannheim, Germany) в соответствии с инструкциями производителя.Идентичное количество клеток для каждого типа клеток и эксперимента высевали в исследуемые лунки. Все образцы были проанализированы в двух экземплярах.

Определение слияния клеток и площади окрашенных PI

клеток. Через 24 часа окрашивали 20 мкг / мл PI (# 421301, Biolegend, Fell, Германия), разведенными в свежей клеточной среде при КТ, защищенной от света.Визуализация с помощью сканера SYNENTEC NYONE ® Scientific SC4 Cell Imager была выполнена через 24 часа. Полученные изображения впоследствии были проанализированы с помощью соответствующего программного обеспечения YT ® .

Выделение РНК и RT-qPCR

. Общую РНК выделяли с использованием набора для тотальной РНК peqGOLD (№ 12-6834-02, PeqLab, Эрланген, Германия) и подвергали обратной транскрипции с использованием Oligo dT Primer (№ SO-132), ингибитора РНК Ribolock. (# EO-0382), dNTP-Mix (# RO-193) и обратная транскриптаза Revert Aid M-MLV (# EP-0442) (все от Fermentas через Thermo Fisher Scientific, Дармштадт, Германия) в соответствии с инструкциями производителя.Количественный ПЦР-анализ в реальном времени выполняли как двойной анализ на LightCycler 480 (Roche Diagnostics, Mannheim, Germany), включая анализ кривой плавления в качестве контроля качества. Праймеры, последовательности праймеров и температуры отжига перечислены в таблице 3.

10.1371 / journal.pone.0239369.t003 Таблица 3 Название гена, а также последовательности, температуры отжига и производители человеческих и мышиных праймеров.
Праймеры для человека
Ген Последовательность праймера Отжиг ° C Производитель
GAPDH Fw-TCCATGACAACTTTGGTATCGTGG 58 Eurofins, Гамбург, Германия
Rv-GACGCCTGCTTCACCACCTTCT
ИЛ1-β Fw-AGTGCTCCTTCCAGGACCTGGA 58 Eurofins, Гамбург, Германия
Rv-CACTCTCCAGCTGTAGAGTGG
Ил-6 Fw-ATGCAATAACCACCCCTGAC 58 Праймеры в реальном времени, Элкинс Парк, США
Rv-GAGGTGCCCATGCTACATTT
Ил-8 Fw- GTGTGAAGGTGCAGTTTTGCC 55 Eurofins, Гамбург, Германия
Rv- AACTTCTCCACAACCCTCTGC
Ил-10 Fw-AAGCCTGACCACGCTTTCTA 58 Праймеры в реальном времени, Элкинс Парк, США
Rv-ATGAAGTGGTTGGGGAATGA
TNF-α Fw-TCCTTCAGACACCCTCAACC 58 Eurofins, Гамбург, Германия
Rv-AGGCCCCAGTTTGAATTCTT
TGF-β1 Fw-CGTGGAGCTGTACCAGAAATA 58 Eurofins, Гамбург, Германия
Rv-TCCGGTGACATCAAAAGATAA
Мышиные праймеры
Ген Последовательность праймера Отжиг ° C Производитель
GAPDH Fw-TCCATGACAACTTTGGTATCGTGG 58 Eurofins, Гамбург, Германия
Rv-GACGCCTGCTTCACCACCTTCT
mIL1-β Fw-ATCCTCTGTGACTCATGGGAT 55 Biometra, Геттинген, Германия
Rv-GATCCACACTCTCCAGCTGCA
мИЛ-6 Fw-TAGTCCTTCCTACCCCAATTTCC 58 Eurofins, Гамбург, Германия
Rv-TTGGTCCTTAGCCACTCCTTC
МИЛ-10 Fw-AGTGGAGCAGGTGAAGAGTG 58 Праймеры в реальном времени, Элкинс Парк, США
Rv-TTCGGAGAGAGGTACAAACG
мTNF-α Fw-CCCACTCTGACCCCTTTACT 58 Eurofins, Гамбург, Германия
Rv-TTTGAGTCCTTGATGGTGGT
mTGF-β1 Fw-GCTGAACCAAGGAGACGGAA 58 Eurofins, Гамбург, Германия
Rv-AGAAGTTGGCATGGTAGCCC
Статистика

Статистический анализ проводился с использованием SigmaPlot v12.5 предоставлено Systat. Сначала данные были проверены на нормальность и равную дисперсию с помощью теста Шапиро-Уилка и теста равной дисперсии соответственно. Для сравнения двух групп, состоящих из параметрических распределенных наборов данных, применялся t-критерий. Две группы наборов данных, которые не прошли тест на нормальность или равную дисперсию, были проанализированы с помощью критерия суммы рангов Манна-Уитни. Параметрические данные нескольких групп проверяли с помощью одностороннего дисперсионного анализа (односторонний дисперсионный анализ) на предмет статистической значимости. Непараметрические наборы данных из нескольких групп были проанализированы с помощью одностороннего дисперсионного анализа Краскела-Уоллиса по критерию ранжирования.Статистически значимые различия между группами предполагались при p-значениях <0,05 в соответствии с методом Стьюдента-Ньюмана-Кеулса (параметрические данные) и методом Данна (непараметрические данные), соответственно. Статистически значимые различия с p-значениями <0,05 отмечены одной звездочкой *.

Результаты Поглощение CNP различными популяциями APC

Во-первых, было исследовано, поглощаются ли CNP различными популяциями APC и является ли размер частиц решающим фактором эффективности поглощения.Для этой цели первичные DC человека, M1- и M2-макрофаги, а также линия DC2.4 мыши инкубировали со 100 мкг / мл CNP в течение 24 часов. Хитозан, обладающий различными молекулярными массами (90/10, 90/20 и 90/50), был использован для генерации CNP, что привело к разным размерам частиц. Чтобы настроить анализ интернализации CNP с помощью визуализирующей цитометрии, клеточная мембрана DC человека была помечена иммунофлуоресцентным окрашиванием поверхности клеток CD11c-APC, что позволило четко различать внутриклеточное поглощение меченных FITC CNP (рис. 1A, верхний ряд) только от CNP. связаны с (клеточной) поверхностью DC человека (рис. 1A, нижний ряд).Внутриклеточное поглощение 90/10-CNP в человеческих DCs было дополнительно проанализировано с помощью IF- и CLS-микроскопии, подтвердив, что визуализирующая цитометрия является подходящим методом для правильного определения поглощения CNP (рис. 1B). Таким образом, поглощение CNP было проанализировано в разных популяциях APC с помощью визуализирующей цитометрии, показавшей, что CNP трех разных размеров поглощаются всеми популяциями APC, хотя и в разной степени (30–70%) (Рис. 1C). В целом, самая высокая доля клеток с интернализованными FITC-конъюгированными CNP (60–70%) может наблюдаться после инкубации с самыми крупными CNP (90/50) в каждой клеточной популяции / линии.Инкубация с наименьшими CNP (90/10) привела к более высокому проценту DC (мышиных и человеческих), показывающих интернализацию CNP, по сравнению с обеими популяциями макрофагов. Рассматривая применение вакцины на основе CNP в дыхательных путях, затем было исследовано, действительно ли CNP все еще эффективно поглощаются DC, если они встроены в микроокружение эпителия легких. Интересно, что когда человеческие DC напрямую культивировали с человеческими эпителиальными клетками h541, представляющими эпителиальный барьер легких, поглощение CNP наблюдалось в обеих популяциях.Однако поглощение было явно выше в DC (65–74% внутриклеточно окрашенных клеток) по сравнению с клетками h541 (38–46% внутриклеточно окрашенных клеток) (рис. 1D). В целом эти данные показывают, что CNP разных размеров эффективно используются APC, а лучше всего – DC.

10.1371 / journal.pone.0239369.g001 Рис. Поглощение CNP человеческими и мышиными APC.

Различные популяции APC инкубировали со 100 мкг / мл CNP разного размера (90/10, 90/20 и 90/50) в течение 24 часов. A) Типичные изображения первичных дендритных клеток (DC) человека, которые инкубировали с 90/10-CNP и анализировали с помощью цитометрии с визуализацией; I показывает DC с интернализованными CNP, II показывает DC с внутри- и внеклеточными CNP; BF = светлое поле; красный = окрашивание мембран CD11c-APC DC; зеленый = FITC-конъюгированные CNP; наложение.B) Типичные изображения иммунофлуоресцентной (IF) и конфокальной лазерной сканирующей микроскопии (CLS) ДК, инкубированных с 90/10-CNP; синий = ядерное контрастное окрашивание Hoechst; красный = окрашивание мембраны CD11c-APC; зеленый = FITC-конъюгированные CNP. C) Цитометрический анализ захвата CNP первичными человеческими DC, мышиными DC линией DC2.4 и человеческими M1- или M2-макрофагами (Mᶲ). D) Визуализирующий цитометрический анализ поглощения CNP совместно культивированными DC человека и эпителиальными клетками легких человека h541 после 24-часовой инкубации с CNP. Данные выражены как% внутриклеточно окрашенных клеток и как среднее значение + стандартная ошибка среднего из трех независимых экспериментов.* р <0,05.

Поглощение крупных CNP токсично для APC

Затем было исследовано, влияет ли поглощение CNP на выживаемость различных популяций APC. Следовательно, человеческие DC, M1- и M2- макрофаги либо оставляли необработанными, либо инкубировали со 100 мкг / мл CNP разного размера (90/10, 90/20 и 90/50) в течение 24 часов, а затем анализировали на предмет индукции гибели клеток. . Сначала определяли активность каспазы-3/7 как индикатор индукции апоптоза. По сравнению с необработанными клетками значительное (5-кратное) увеличение активности каспазы-3/7 наблюдалось в DC только после инкубации с 90/50-CNP, тогда как обработка 90/20-CNP вызывала 2-кратное увеличение и 90 / 10-CNP даже только 1.5-кратное увеличение (рис. 2А). Напротив, обе популяции макрофагов показали как минимум 3-кратное повышение активности каспазы-3/7 после инкубации с CNP любого размера по сравнению с необработанными макрофагами (фиг. 2A). Поскольку DC находятся в фокусе нашего исследования, CNP-опосредованная индукция клеточной гибели была дополнительно исследована в этих клетках. В соответствии с низкой активностью каспазы-3/7, слияние клеток DC, обработанных 90/10-CNP, было сравнимо с таковым для необработанных клеток (фиг. 2B). Однако в лунках с DC, которые обрабатывали 90/20-CNP, наблюдали явно пониженную конфлюэнтность, эффект, который был даже сильнее после стимуляции 90/50-CNP по сравнению с необработанным контролем.Более того, оставшиеся прикрепленные DC в этих лунках больше не проявляли типичную морфологию дендритных клеток, которую можно наблюдать для необработанных или обработанных 90/10-CNP клеток (фиг. 2B). Соответственно, подробный анализ дифференцированно обработанных DC окрашиванием пропидиум йодидом (PI) дополнительно подтвердил эти данные и выявил значительное снижение слияния клеток (рис. 2C), а также значительное увеличение площади клеток PI + с увеличением размера CNP (рис 2D). Таким образом, эти данные предполагают, что инкубация с CNP увеличивающегося размера ухудшает выживаемость APC, особенно DC.Поскольку обработка небольшими CNP (90/10) лучше всего переносилась DC, не нарушая их жизнеспособность, для дальнейших экспериментов были выбраны 90/10-CNP.

10.1371 / journal.pone.0239369.g002 Рис. Поглощение крупных CNP токсично для APC.

Первичные человеческие DC, M1- и M2-макрофаги (Mᶲ) либо оставляли необработанными (ut), либо инкубировали со 100 мкг / мл CNP разного размера (90/10, 90/20 и 90/50) в течение 24 часов. А) На графиках представлена ​​относительная активность каспазы-3/7. Данные представлены как n-кратная активность каспазы-3/7 для необработанных клеток и как медиана с 75-м и 25-м процентилями для четырех независимых экспериментов (DC) или как среднее значение + SEM для трех независимых экспериментов (M1- и M2-Mᶲ).B) Типичные изображения фазового контраста DC либо оставлены необработанными, либо инкубированы в течение 24 часов с указанными CNP. Изображения были получены при 280-кратном увеличении. C-D) DC окрашивали йодидом пропидия (PI) после указанной обработки и определяли (C) слияние клеток, а также (D) площадь PI +. Данные выражены в n-кратном размере для необработанных клеток и в виде среднего + SEM трех независимых экспериментов. * р <0,05.

Поглощение CNP способствует провоспалительному фенотипу DC

. Показав, что 90/10-CNP поглощается ~ 50% популяции и меньше всего влияет на выживаемость DC, было исследовано, являются ли CNP пустыми или загруженными модельный антиген SIINFEKL (OVA 257–264) – изменение фенотипа этих клеток.Таким образом, первичные человеческие DC и мышиная линия DC DC2.4 либо не обрабатывали, либо обрабатывали 100 мкг / мл пустыми (90/10) или загруженными SIINFEKL 90/10-CNP (90/10-SIINFEKL) в течение 5, 24 и 48 часов соответственно. Проточный цитометрический анализ уровней костимулирующих молекул CD80 и CD86, а также HLA-DR и коингибиторного белка PD-L1 на клеточной поверхности не выявил значительных изменений в обработанных человеческих DCs по сравнению с необработанными клетками (фиг. 3A, S2, фиг.). Более того, не наблюдалось явных эффектов в отношении экспрессии противовоспалительных цитокинов, таких как TGF-β1 и IL-10 (рис. 3B).Напротив, экспрессия провоспалительных медиаторов IL-1β, IL-6 и TNF-α была сильно повышена после инкубации с загруженными SIINFEKL 90/10-CNP в течение 5-48 часов по сравнению с инкубацией с пустыми CNP (рис. 3B). ). Подобные, но менее выраженные эффекты наблюдались в мышиных клетках DC2.4 после инкубации с CNP, нагруженными пептидами. Здесь уровни экспрессии провоспалительных медиаторов IL-6, TNF-α и IL-1β были заметно повышены и достигли пика через 48 часов после добавления загруженного SIINFEKL 90/10-CNP и одновременно достигли заметно более высоких уровней, чем после обработки пустыми CNP. что указывает на антиген-специфический ответ (рис. 3C).Как наблюдали в человеческих DC, экспрессия TGF-β1 почти не пострадала (рис. 3C). В целом, эти данные позволяют предположить, что в человеческих DC, особенно пептид SIINFEKL, но не CNP (и, следовательно, хитозан) сами по себе способствуют приобретению провоспалительного фенотипа, в то время как в мышиной клеточной линии DC2.4 оба компонента способствуют экспрессии провоспалительного цитокины, как ожидается, для антиген-специфического иммунного ответа.

10.1371 / journal.pone.0239369.g003 Рис. Поглощение CNP способствует провоспалительному фенотипу DC.

DC человека и мыши (DC2.4) либо оставляли необработанными, либо инкубировали с пустыми 100 мкг / мл (90/10) или загруженными SIINFEKL 90/10-CNP в течение 5, 24 и 48 часов. A) Проточно-цитометрический анализ уровней клеточной поверхности CD80, CD86, HLA-DR и PD-L1 в человеческих DC. Отношение средней интенсивности флуоресценции (MFI) рассчитывали путем нормализации MFI каждого поверхностного маркера к MFI соответствующего изотипического контроля. Затем соотношение MFI обработанных CNP клеток нормализовали к необработанным клеткам и выражали как n-кратное MFI необработанных клеток.B + C) Относительные уровни мРНК TGF-β1, IL-10, IL-1β, IL-6 и TNF-α в B) первичных человеческих DC и C) мышиных DC2.4 клетках определяли с помощью RT-qPCR. Уровни экспрессии были нормализованы к экспрессии гена домашнего хозяйства TBP / GAPDH и нормализованы к значениям, определенным для необработанных клеток. Данные представлены как среднее значение + стандартная ошибка среднего или медиана с процентилями 75 и 25 трех независимых экспериментов. * р <0,05.

Поглощение SIINFEKL-нагруженных CNP DC эффективно стимулирует антиген-специфическую активацию и размножение CD8 + OT-1 T-лимфоцитов

Чтобы вызвать опосредованный опухолью CD8 + T-клеточный иммунный ответ посредством вакцинации CNP, нагруженные пептиды должны быть должным образом представлены посредством Комплексы MHC-I на DC приводят к активации и размножению антиген-специфических CD8 + Т-клеток.Инкубация клеток DC2.4 с загруженными 100 мкг / мл SIINFEKL 90/10-CNP в разные моменты времени показала, что самый высокий уровень SIINFEKL, связанного с молекулами H-2Kb, обнаруживался через 5 часов (рис. 4A). Таким образом, все дальнейшие эксперименты были проанализированы после инкубации с загруженными SIINFEKL CNP в течение 5 часов. Подтверждая специфичность антитела, SIINFEKL, связанный с комплексом H-2Kb, не обнаруживался на клеточной поверхности клеток DC2.4 после инкубации с пустыми 90/10-CNP в течение 5 часов (соотношение MFI = 1). Напротив, SIINFEKL, связанный с комплексом H-2Kb, сильно присутствовал на поверхности DC2.4 клетки инкубировали с неупакованным (растворимым) пептидом SIINFEKL (соотношение MFI = 17,5) или загруженными SIINFEKL 90/10-CNP (соотношение MFI = 6) (рис. 4B).

10.1371 / journal.pone.0239369.g004 Рис. Поглощение загруженных SIINFEKL CNP DC эффективно стимулирует активацию и размножение CD8 + OT-1 Т-клеток.

A) Клетки DC2.4 либо оставляли необработанными, либо обрабатывали 100 мкг / мл загруженных SIINFEKL 90/10-CNP в течение 1, 5, 9 и 24 часов или B) Клетки DC2.4 обрабатывали пустыми 100 мкг / мл (90/10) или загруженных SIINFEKL 90/10-CNP или 1 мкг / мл SIINFEKL в течение 5 часов.SIINFEKL, связанный с молекулами H-2Kb, определяли методом проточной цитометрии. Отношение средней интенсивности флуоресценции (MFI) рассчитывали путем нормализации MFI окрашивания антителом против SIINFEKL-H-2Kb к MFI, обнаруженному при окрашивании с его соответствующим изотипическим контролем (n-кратный MFI). В A) соотношение MFI обработанных клеток также нормализовали к MFI обработанных через 1 час клеток и выражали как n-кратное значение MFI необработанных клеток. В) CD8 + Т-лимфоциты ОТ-1 выделяли из селезенки мышей ОТ-1. Чистоту CD8 + OT-1 Т-клеток определяли после отрицательного отбора MACS с помощью окрашивания CD8 и проточного цитометрического анализа.Показан один репрезентативный дот-блот. D-F) Клетки DC2.4 либо оставляли необработанными, либо обрабатывали 100 мкг / мл пустыми (90/10) или 100 мкг / мл загруженных SIINFEKL 90/10-CNP или 1 мкг / мл SIINFEKL в течение 5 часов. После этого дифференцированно обработанные клетки DC2.4 сокультивировали с CD8 + Т-лимфоцитами ОТ-1 в течение 72 часов. D) Типичные фазово-контрастные изображения Т-клеток CD8 + OT-1, совместно культивируемых с клетками DC2.4, которые либо не обрабатывались, либо подвергались указанной обработке. Масштабная линейка = 1000 мкм. E) Количество жизнеспособных CD8 + OT-1 Т-лимфоцитов определяли после указанного режима совместного культивирования.Данные представлены как среднее значение + стандартная ошибка среднего из трех независимых экспериментов. F) Проточно-цитометрический анализ активации Т-клеток путем окрашивания CD25, CD44 и CD69 клеточной поверхности CD8 + OT-1 Т-клеток непосредственно после выделения и после сокультивирования с клетками DC.24, предварительно обработанными SIINFEKL или 90/10-SIINFEKL CNP. . Показаны репрезентативные гистограммы из одного из 3 независимых экспериментов, а гистограммы представляют% CD8 + OT-1 T-клеток, положительных по экспрессии CD25, CD44 и CD69 на клеточной поверхности, соответственно.Данные представлены как среднее значение + стандартная ошибка среднего из трех независимых экспериментов. * р <0,05.

Чтобы проверить, обладают ли клетки DC2.4, представляющие пептид SIINFEKL через комплекс H-2Kb, способность стимулировать активацию CD8 + Т-клеток, клетки DC2.4, оставленные необработанными или инкубированные с неупакованным пептидом SIINFEKL, пустые 90/10-CNP или Нагруженные SIINFEKL 90/10-CNP совместно культивировали с CD8 + OT-1 Т-клетками, несущими трансгенный Т-клеточный рецептор, специфичный для H-2Kb-связанного SIINFEKL. Для этой цели CD8 + OT-1 Т-клетки выделяли из селезенки мышей OT-1 путем отрицательной селекции MACS, обеспечивая нетронутые популяции CD8 + OT-1 Т-клеток высокой чистоты (> 90%) (рис. 4C).Затем контрольные и предварительно обработанные клетки DC2.4 отделяли, промывали для удаления CNP и пептида SIINFEKL, которые не были поглощены клетками DC2.4, и высевали для сокультивирования. Как только клетки DC2.4 прикрепились к поверхности чашки для культивирования, изолированные CD8 + OT-1 T-клетки были добавлены для совместного культивирования и стимулированы mIL-2, который необходим для выживания потенциально активированных T-клеток. Световой микроскопический анализ после 72 часов совместного культивирования показал, что кластеры CD8 + OT-1 Т-клеток сформировались вокруг клеток DC2.4 во всех четырех условиях совместного культивирования.Однако эти кластеры были намного больше по количеству и размеру в условиях совместного культивирования CD8 + OT-1 Т-клеток с клетками DC2.4, которые были предварительно обработаны неупакованным пептидом SIINFEKL или загруженными SIINFEKL 90/10-CNP, чем в условиях совместного культивирования с DC2. 4 клетки, которые не были обработаны или предварительно инкубированы только с пустыми 90/10-CNP (рис. 4D). В соответствии с этими результатами, количество жизненно важных клеток CD8 + OT-1 Т-клеток было значительно выше после совместного культивирования с клетками DC2.4, предварительно обработанными неупакованными SIINFEKL или загруженными SIINFEKL 90/10-CNP, чем после сокультивирования с ранее необработанными или пустыми 90/10 -CNP обработанный DC2.4 ячейки (рис. 4E). Более того, проточный цитометрический анализ выявил заметно увеличенную долю CD8 + OT-1 Т-клеток, позитивных по маркерам активации Т-клеток CD25, CD44 и CD69 после совместного культивирования с клетками DC2.4, которые были предварительно обработаны неупакованным SIINFEKL или загруженным SIINFEKL 90/10. -CNP по сравнению со свежевыделенными CD8 + OT-1 Т-клетками (рис. 4F). Таким образом, эти данные демонстрируют, что обработка клеток DC2.4 нагруженными SIINFEKL 90/10-CNP приводила к такой же мощной активации и размножению SIINFEKL-специфичных CD8 + OT-1 Т-клеток, как и обработка неупакованным пептидом SIINFEKL, хотя и с экспрессией H SIINFEKL, связанный с размером 2Kb, был выше после обработки неупакованным пептидом SIINFEKL.

CD8 + OT-1 T-клетки, активированные SIINFEKL, представляющими DC, после поглощения SIINFEKL-нагруженных CNP, эффективно убивают SIINFEKL-экспрессирующие опухолевые клетки

Показав, что обработка клеток DC2.4 нагруженными SIINFEKL 90/10-CNP приводила к активации и размножению CD8 + OT-1 T-клетки, затем было исследовано, способны ли эти активированные CD8 + T-клетки убивать опухолевые клетки антиген-специфическим образом. Для этой цели мышиную линию клеток PDAC Panc02 и ее SIINFEKL, экспрессирующую производное Panc-OVA, совместно культивировали с CD8 + Т-клетками OT-1, полученными из сокультив с дифференцированно предварительно обработанным DC2.4 клетки в течение 24 часов для анализа уничтожения опухолевых клеток. Как показано на фиг. 5A и 5B, на слияние клеток Panc02 и Panc-OVA не влияли CD8 + OT-1 Т-клетки из сокультуры с необработанными или стимулированными 90/10-CNP клетками DC2.4. Напротив, уменьшенное слияние клеток Panc02 и Panc-OVA наблюдалось в присутствии CD8 + OT-1 Т-клеток из сокультуры с клетками DC2.4, предварительно обработанными пептидом SIINFEKL или загруженными SIINFEKL 90/10-CNP. Примечательно, что это снижение слияния клеток было гораздо более выраженным в клетках Panc-OVA, инкубированных с CD8 + OT-1 Т-клетками из сокультуры с SIINFEKL (0.32 раза) или загруженных SIINFEKL клеток DC2.4, обработанных 90/10-CNP (0,21 раза), чем в клетках Panc02 в аналогичных условиях (SIINFEKL: 0,78 раза; 90/10-SIINFEKL: 0,73 раза). В целом, эти данные подчеркивают, что активация CD8 + OT-1 T-клеток DC, обработанными SIINFEKL-нагруженными 90/10-CNP, приводит к антиген-специфической экспансии CD8 + T-клеток и антиген-специфическому, эффективному уничтожению опухолевых клеток.

10.1371 / journal.pone.0239369.g005 Рис. CD8 + OT-1 Т-клетки, активированные SIINFEKL, представляющими DC, после поглощения SIINFEKL-нагруженных CNP, эффективно убивают опухолевые клетки, экспрессирующие SIINFEKL.

Клетки Panc02 и Panc-OVA совместно культивировали с CD8 + Т-лимфоцитами OT-1, полученными в результате предыдущего совместного культивирования с клетками DC2.4, которые либо не обрабатывали, либо обрабатывали пустыми 100 мкг / мл (90/10) или загруженными SIINFEKL 90 / 10-CNP или пептид SIINFEKL 1 мкг / мл. Через 24 часа CD8 + OT-1 Т-клетки удаляли из лунок и A) получали изображения фазового контраста (шкала = 500 мкм) и B) определяли клеточное слияние опухолевых клеток. Относительное слияние клеток Panc02 и Panc-OVA после любого указанного лечения представлено как n-кратное слияние клеток, определенное в культурах соответствующих клеток Panc02 и Panc-OVA, которые культивировались с CD8 + Т-лимфоцитами OT-1 из предыдущего совместного культивирования с необработанным DC2.4 кл. Данные представлены как среднее значение + стандартная ошибка среднего из трех независимых экспериментов. * р <0,05.

Обсуждение

Вакцинация успешно используется в терапии онкологических заболеваний, приводящих к индукции (долгосрочного) ответа CD8 + Т-клеток против раковых клеток [48, 49]. Большинство вакцин вводят внутримышечно или подкожно, однако введение через слизистые оболочки считается более эффективным и успешно применяется в нескольких программах вакцинации [50, 51]. Это происходит из-за провокации иммунного ответа слизистой оболочки, который индуцируется локальным процессингом антигена и вызывает сильный цитотоксический Т-клеточный ответ, особенно при введении через верхние дыхательные пути [52].Слизистая оболочка дыхательных путей хорошо оснащена иммунными клетками, поскольку она является основным потенциальным входным портом для переносимых по воздуху патогенов и, следовательно, требует хорошей защиты. ДК присутствуют в бифуркациях бронхов и в эпителии легких [53]. В слизистой оболочке носа DCs могут быть сконцентрированы в ассоциированной с носом лимфоидной ткани и по всему носовому эпителию [54]. В этом контексте вакцинация слизистой оболочки носа представляется наиболее привлекательной, поскольку это неинвазивный, простой и безболезненный подход, предполагающий более строгую приверженность пациентов [24, 55, 56].Однако большинство антигенов, вводимых в качестве вакцинации слизистых оболочек, не вызывали сильных CD8 + Т-клеточных ответов из-за плохого проникновения пептидов через эпителиальный барьер или клиренса слизистой оболочки [57]. Представляется важным, чтобы антиген специфически доставлялся системой-носителем антигена в виде частиц [58, 59]. Таким образом, было показано, что интраназальная вакцинация с использованием соответствующих систем доставки антигенов, таких как CNP, сильно увеличивает захват антигена и индуцирует опосредованный Т-клетками иммунитет [60–62]. Помимо этих многообещающих достижений, параметры, определяющие иммуногенность, должны быть дополнительно выяснены, чтобы улучшить эту стратегию, особенно для очень злокачественных заболеваний, таких как PDAC.Наше исследование с использованием CNP показало, что размер CNP (200-700 нм) не оказывает значительного влияния на поглощение CNP отдельными APC, но является критическим детерминантом, влияющим на выживаемость APC, особенно DC, которые жизненно важны для примирования и активации Т-клеток. Таким образом, выживаемость ДК была максимальной после воздействия самых маленьких ХНЧ (90/10). В то время как некоторые исследования также показали, что APC способны захватывать и обрабатывать частицы антигенов размером от 20 нм до 3 мкм без явного предпочтения определенного диапазона размеров [11], другие исследования ясно показывают, что поглощение загруженных антигеном CNP DC и макрофагами зависит от размера частиц, концентрации инкапсулированного антигена, а также времени воздействия APC на CNP [63].Как указано выше, хитозан оказался хорошо подходящим для доставки нуклеиновых кислот и антигенов в нескольких исследованиях [60–62]. Здесь преимущество перед другими материалами объясняется его катионной природой и, таким образом, способностью CNPs способствовать эндосомному разрушению и высвобождению своего груза в цитозоль [64]. Однако механизм захвата иммунокомпетентными клетками, такими как ДК, полностью не выяснен, но считается, что он опосредуется фагоцитозом или макропиноцитозом [65].Собственные данные показали, что при захвате CNP остаются в вакуолеподобных структурах рядом с клеточной мембраной, которые не подкисляются [66].

Для вакцинации слизистой оболочки, кажется, предпочтительным является размер более 100 нм, поскольку более мелкие частицы быстро отводятся к лимфатическим узлам без взаимодействия с местной иммунной системой [67]. Однако собственное исследование показало, что может быть оптимальный размер около 200–400 нм в зависимости от клетки-мишени и материала, из которого состоит частица [20, 68]. Преимущество более крупных частиц состоит в том, что они также доставляют в ячейку большее количество груза, если их принимают.Однако клеткам также необходимо справляться с большим количеством материала, который может препятствовать их жизнеспособности. В отличие от других полимерных наночастиц, таких как частицы сополимера молочной и гликолитовой кислоты (PLGA), которые медленно биоразлагаются и легко диспергируются в жидкости, CNP состоят из гидрогелеподобного биополимера. В водной среде эти наночастицы проявляют набухание, гелеобразная структура, которая приводит к образованию агломератов липких частиц и позволяет интенсивно взаимодействовать с клеточными поверхностями, как показывают исследования поглощения частиц [66].Визуализирующая цитометрия, но не анализ традиционной проточной цитометрии, показал, что CNP интенсивно прилипают к поверхности клеток и не могут быть легко смыты. CNP могут быть получены в водной среде без использования какого-либо органического растворителя. Это особенно полезно с точки зрения биосовместимости. Кроме того, мы продемонстрировали, что воздействие 90/10-CNP, нагруженных пептидом SIINFEKL, но не пустых CNP, способствует провоспалительному фенотипу DC, на что указывает повышенная экспрессия провоспалительных цитокинов, таких как TNF-α, IL-1β и IL- 6.Хотя в нашей системе только CNP вряд ли влияют на фенотип уже дифференцированных APC, Oliveira et al. продемонстрировали, что воздействие хитозана на моноциты во время дифференцированной культуры способствует поляризации провоспалительного фенотипа в макрофагах и ДК [69]. Эти расходящиеся результаты могут быть объяснены следующими фактами: i) хитозан влияет скорее на поляризацию, чем на эффекторную функцию уже дифференцированных APC. Следовательно, когда APC уже поляризованы до определенного фенотипа, хитозан сам по себе недостаточно эффективен для сдвига поляризации, тогда как, когда он доступен в качестве основного фактора поляризации, он способствует дифференцировке в провоспалительный фенотип.ii) Провоспалительный эффект хитозана проявляется только тогда, когда клетки подвергаются воздействию полимера в течение определенного времени. Oliveira et al. проанализировали влияние хитозана на поляризацию моноцитов в течение периода времени 3–10 дней с моноцитами, проявляющими провоспалительный фенотип раньше всего после культивирования на хитозане в течение 7 дней [69]. Напротив, мы проанализировали фенотипические изменения у ДК, подвергшихся воздействию хитозана в течение 5–48 часов.

Независимо от того, применяется ли хитозан отдельно или в комбинации с пептидами, стимулирование провоспалительного фенотипа в APC оказывается весьма полезным при лечении раковых заболеваний, чтобы преодолеть иммуносупрессивные состояния у пациентов и внутри опухоли.Несмотря на то, что не только APC, но и эпителиальные клетки способны поглощать 90/10-CNP – хотя и в меньшей степени, чем при сокультивировании, ~ 65% DC и только ~ 38% клеток h511 показали поглощение FITC-конъюгированных CNP. –Наши данные и другие исследования подтверждают пригодность CNP в качестве средств эффективного поглощения DC [70, 71]. Наконец, наше исследование показало максимальное представление комплекса SIINFEKL-MHC-I на клеточной поверхности ДК через 5 часов. Другими группами уже было продемонстрировано, что перекрестная презентация экзогенных антигенов OVA посредством DC происходит быстро, что было определено, например, e.г. от 6 до 16 часов [72–74]. Сильное снижение презентации SIINFEKL, связанной с H-2Kb, в клетках DC2.4 через 24 часа может быть объяснено отсутствием дополнительных стимулов созревания (например, таких как LPS, TNF-α или Poly I: C) во время стимуляции CNP. Как показано Kukutsch et al., Экспрессия комплексов антиген / H-2Kb на клеточной поверхности DC может быть увеличена до 72 часов при предварительной обработке клеток LPS или Poly I: C [74].

Важно отметить, что нанесение антигенов в виде частиц гораздо более эффективно для индукции иммунного ответа, чем вакцинация растворимыми антигенами, поскольку системы-носители лекарственного средства могут дополнительно эффективно инкапсулировать и защищать чувствительные антигены и предпочтительно нацеливать груз на APC [39, 54, 66, 67].

В заключение, наше исследование решительно поддерживает пригодность CNP в качестве носителя антигена для индукции мощных антиген-специфических Т-клеточных ответов, что согласуется с данными других исследований [63]. Наше исследование ясно предполагает, что CNP, особенно небольшого размера, являются наиболее мощным носителем антигена, потому что мы могли продемонстрировать, что i) CNP эффективно поглощаются DC, те APC, которые необходимы для праймирования и активации CD8 + Т-клеток, ii) представлен доставленный CNP антиген. в контексте MHC-I посредством DC, iii) DC, стимулированные CNP-нагруженным антигеном, приводят к активации и размножению опухолевых антиген-специфичных CD8 + Т-клеток и, наконец, к индукции мощного противоопухолевого ответа.Будущие исследования должны подтвердить терапевтический потенциал CNP как системы доставки антигена на доклинических моделях мышей PDAC.

Robert Schwagerus berät Mediziner -Firmen

Роберт Швагерус: Finanzberater mit ausgewiesener Expertise

Der selbständige Finanzberater Robert Schwagerus und sein Team unterstützen Kunden in allen Bereichen des Vermögensaufbaus und Versicherungsmanagements und helfen ihnen dabei, Mehrwerte und Renditen zu erzielen.

Bereits seit vielen Jahren am Markt tätig, Hat der Finanz- und Versicherungsexperte ganzheitliche Vorsorgelösungen entwickelt, die insbesondere die Bereiche Altersvorsorge, Gesundheit, Einkommenssicherung, Sach- und Vermöungsensexperte.

Ursprünglich strebte Robert Schwagerus aufgrund seines Interesses für Medizin eine berufliche Karriere in der Pharmaziebranche an. Während seines Abiturs kam er dann jedoch mit dem Finanzsektor in Kontakt und absolvierte anschließend dort seine Ausbildung.Er wurde Teamleiter und baute sich als Bezirksdirektor eine eigene Kanzlei für die Finanzberatung auf, die aktuell stark expandiert.

Seine Expertise und die Individual zugeschnittenen Konzepte für die Finanzplanung, die Senkung von Steuerlasten und den optimalen Versicherungsschutz werden deutschlandweit von vielen Ärzten anerkannt und genutzt.

Egal ob ein Arzt freiberuflich oder angestellt ist, sie sind nicht über die gesetzliche Rentenversicherung abgesichert, sondern Mitglieder im ärztlichen Versorgungswerk.Dies birgt ein gewisses Risiko, nicht ausreichend versichert zu sein. Daher zählen Mediziner zu einer Hauptzielgruppe des Versicherungsprofis Robert Schwagerus.

Eine All-in-one-Lösung für die Finanzberatung

Robert Schwagerus berät Professionalell in allen finanziellen Belangen

Роберт Швагерус

Ob Einkommenssicherung, Gesundheitsvorsorge или Altersvorsorge – die Themen Finanzen und Absicherung sind von essenzieller Bedeutung.Daher ist es wichtig, sich möglichst frühzeitig um den Vermögensaufbau zu kümmern und das Einkommen abzusichern. Doch Anleger und Sparer sind oft unsicher, welche Geldanlage für den Vermögensaufbau am besten geeignet ist. Auch fehlt vor allem Ärzten meist die Zeit, sich genauer über Anlagemöglichkeiten zu informieren.

Der Finanzberater für Ärzte Robert Schwagerus und sein Partnerunternehmen ProVentus, ein Teil der Swiss Life Deutschland, unterstützen ihre Kunden daher dabei, die optimale Kapitalanlage zu finden.Das Produktportfolio umfasst über 150 qualitätsgeprüfte Banken, Versicherungen, Bausparkassen, Fondsgesellschaften und Finanzdienstleister.

Um die ideale Lösung zu ermitteln, besprechen die Berater von der Finanzkanzlei Schwagerus & Partner die aktuelle Finanz- und Vorsorgesituation über Video-Calls ausführlich mit dem Kunden und analysieren Diese mittelsplanungs einer Finanware. Das digitale Tool ermöglicht es, auf dem iPad schnell die wesentlichen Eckpfeiler der finanziellen Ist- und Wunsch-Situation zu ermitteln.Einflussfaktoren wie zum Beispiel eine Veränderung der Inflationsrate oder das Renteneintrittsalter können flexibel angepasst und auf diese Weise mehrere Szenarien durchgespielt werden, um den richtigen jeweungsschutz findenrden können.

Dieses zukunftsweisende Konzept wurde 2016 vom Deutschen Institut für Service-Qualität mit dem Kunden-Innovationspreis ausgezeichnet.

Kunden schätzen Professionalellen Поддержка

Das fachliche Know-how von Robert Schwagerus und seine umfangreiche Praxiserfahrung wissen etliche Kunden zu schätzen.

Von Kundenseite durchweg betont wird die Bereitschaft von Robert Schwagerus und seinen Kollegen, auch außerhalb der Beratungstermine bei dringenden Anliegen schnell zur Verfügung zu stehen. Bei der Beratung werde detailliert auf Fragen und Wünsche eingegangen, so die Klienten.

Das Preis-Leistungs-Verhältnistimme vollständig, berichten die Kunden und loben die hohe Qualität des umfassenden, immer transparent gehaltenen Consultings.

Auch die Digitalisierung des preisgekrönten Beratungskonzepts wird geschätzt.Denn die Banking- und Versicherungs-App myProVentus ermöglicht es, all bestehenden Onlinekonten, Investmentdepots und Versicherungsverträge zu verknüpfen, zentral zu verwalten und immer im Blick zu haben. So fällt kein unnötiger Papierkram mehr an und das Regal bleibt frei von dicken Ordnern, wie ein zufriedener Kunde berichtet.

Der Versicherungsexperte und Finanzprofi Robert Schwagerus und sein Team unterstützen Kunden umfassend in allen Belangen rund um Versicherungsschutz und Vermögensmanagement.

Poetry Slam im Mergener Hof

Поэзия Slam im Mergener Hof

Trier Trier Beim Trierer Poetry Slam “Verbum Varium Treverorum” fliegen am Samstag, 21. Oktober, ab 20 Uhr im Mergener Hof в Трире die verbalen Fetzen, wenn die Dichter mit ihrer selbst verfassten, zeitgenössisiechen die Bürmen-Poesneh. Welche Darbietung, welcher Text, ob gesprochen, geschrien oder geflüstert, hinterlässt beim Publikum den stärksten Eindruck? Bei diesem literarischen Wettbewerb entscheiden die Zuschauer über den Sieg.

Jeder der Künstler hat sieben Minuten Zeit, seinen Text zu präsentieren.Дабей Синд: Ленни Феллинг (Майнц), Юлия Альтмайер (Саарбрюккен), Лассе Самстрём (Прюм), Тилль Тёльпель (Берлин), Селина Швагерус (Франкфурт), Маркус Мюллер (Майнц), Леон Хаккерт, Мишель Сулье (за Лозхаймом).
Einlass ab 19.30 Uhr, Eintritt: sechs Euro, ermäßigt fünf.

Найди гонку

Расстояние от почтового индекса: Любая страна США – СШАAD – АндорраАЭ – Объединенные Арабские ЭмиратыAF – АфганистанAG – Антигуа и БарбудаAI – АнгильяAL – АлбанияAM – АрменияAO – АнголаAQ – АнтарктикаAR – АргентинаAS – Американское СамоаAT – АвстрияAU – АвстралияAW – АрубаАХ – Аландские островаAZ – АзербайджанBA Босния и ГерцеговинаBB – БарбадосBD – БангладешBE – БельгияBF – Буркина-ФасоBG – БолгарияBH – БахрейнBI – БурундиBJ – БенинBL – Сен-БартелемиBM – Бермудские островаBN – Бруней-ДаруссаламBO – Баутия, Многонациональный БалинтэйтБантир, Британия, Бразилия – БотсванаBY – BelarusBZ – БелизCA – CanadaCC – Кокосовые (Килинг) островаCD – Демократическая Республика Конго CF – Центральноафриканская РеспубликаCG – КонгоCH – ШвейцарияCI – Кот-д’ИвуарCK – Острова КукаCL – Чили CM – КамерунCN – ChinaCO – КолумбияCR – Коста-РикаCU – КубаCV – Кабо-ВердеCW – КюрасаоCX – Остров Рождества CY – КипрCZ – Чешская РеспубликаDE – ГерманияDJ – ДжибутиDK – Denm arkDM – ДоминикаDO – Доминиканская РеспубликаDZ – АлжирEC – ЭквадорEE – ЭстонияEG – ЕгипетEH – Западная СахараER – ЭритреяES – SpainET – ЭфиопияFI – ФинляндияFJ – FijiFK – Фолклендские (Мальвинские) острова FM – Микронезия, Федеративные ШтатыFO – Фарерские островаFR – ФранцияGD – ГренадаGE – ДжорджияGF – Французская ГвианаGG – ГернсиGH – ГанаGI – ГибралтарGL – ГренландияGM – ГамбияGN – ГвинеяGP – ГваделупаGQ – Экваториальная ГвинеяGR – ГрецияGS – Южная Георгия и Южные Сандвичевы островаGT – Гватемала Гвинея – ГуамGW – Гвинея и острова МакдональдHN – ГондурасHR – ХорватияHT – ГаитиHU – ВенгрияID – ИндонезияIE – ИрландияIL – IsraelIM – Остров Мэн – ИндияIO – Британская территория в Индийском океанеIQ – ИракIR – Иран, Исламская РеспубликаIS – ИсландияIT – ИталияJE – JerseyJM – ЯмайкаJO – JordanJP – JapanKE – KenyaKG – КыргызстанKH – КамбоджаKI – КирибатиKM – Коморские островаKN – Сент-Китс и НевисKP – Корея, КНДР – Корея, Республика blic ofKW – КувейтKY – Каймановы островаKZ – КазахстанLA – Лаосская Народно-Демократическая РеспубликаLB – ЛиванLC – Сент-ЛюсияLI – ЛихтенштейнLK – Шри-ЛанкаLR – ЛиберияLS – ЛесотоLT – ЛитваLU – ЛюксембургLV – ЛатвияLY – ЛивияMA – МароккоMC – МонакоME – Молдова, Республика Мартин (Французская часть) MG – МадагаскарMH – Маршалловы островаMK – Македония, бывшая югославская Республика ML – MaliMM – МьянмаMN – МонголияMO – MacaoMP – Северные Марианские островаMQ – МартиникаMR – МавританияMS – МонтсерратMT – МальтаMU – МаврикийMV – МальдивыMW – Малави – НамибияNC – Новая КаледонияNE – НигерNF – Остров НорфолкNG – НигерияNI ​​- НикарагуаNL – НидерландыNO – НорвегияNP – НепалNR – НауруНУ – НиуэNZ – Новая ЗеландияOM – OmanPA – PanamaPE – ПеруPF – Французская ПолинезияPG – Папуа-Новая ГвинеяPG – Папуа-Новая Гвинея MiquelonPN – PitcairnPR – Пуэрто-РикоPS – Палестинская территория, ОккупированнаяPT – ПортугалияPW – Палаупия – Пара guayQA – КатарRE – РеюньонRO – РумынияRS – СербияRU – Российская ФедерацияRW – РуандаSA – Саудовская АравияSB – Соломоновы островаSC – СейшелыSD – СуданSE – SwedenSG – СингапурSH – Остров Святой Елены, Вознесение и Тристан-да-КуньяSI – СловенияSJ – Шпицберген – Словакия Сан-МариноSN – СенегалSO – СомалиSR – СуринамSS – Южный СуданST – Сан-Томе и ПринсипиSV – СальвадорSX – Синт-Мартен (голландская часть) SY – Сирийская Арабская РеспубликаSZ – СвазилендTC – Острова Теркс и КайкосTD – ЧадTF – Южные французские территорииTG – ТогоTKTKTK – ТаиландTK – TokelauTL – Тимор-ЛештиTM – TurkmenistanTN – ТунисTO – ТонгаTR – ТурцияTT – Тринидад и ТобагоTV – ТувалуTW – Тайвань, Китайская РеспубликаTZ – Танзания, Объединенная РеспубликаUA – УкраинаUG – УгандаUM – Малые отдаленные острова СШАUY – Уругвай – Святейший Престол – УзбекистанVA Ватикан) VC – Сент-Винсент и ГренадиныVE – Венесуэла, Боливарианская РеспубликаVG – Виргинские острова, BritishVI – Виргинские острова, U.S.VN – ВьетнамVU – ВануатуWF – Уоллис и ФутунаWS – СамоаXK – КосовоYE – YemenYT – MayotteZA – Южная АфрикаZM – ЗамбияZW – Зимбабве Любой штат / провинцияAK – АляскаAL – АлабамаAR – Арканзас – Американское СамоаАЗ – Калифорния, штат Аризона, DC КолумбияДЕ – ДелавэрFL – ФлоридаFM – Федеративные Штаты МикронезииGA – ДжорджияGU – ГуамГИ – Гавайи – IowaID – АйдахоИЛ – ИллинойсIN – ИндианаKS – KansasKY – Кентукки, Лос-Анджелес – ЛуизианаMA – МассачусетсMD – Мэриленд, штат Мэн – Миссиана, штат Миссисипи – Маршалловы острова МиссисипиMT – МонтанаNC – Северная КаролинаND – Северная ДакотаNE – НебраскаNH – Нью-ГэмпширNJ – Нью-ДжерсиNM – Нью-МексикоNV – НевадаNY – Нью-ЙоркOH – ОгайоOK – ОклахомаOR – ОрегонPA – ПенсильванияPR – Пуэрто-РикоPW – Палаури – Родос TexasUT – ЮтаVA – ВирджинияVI – Виргинские острова СШАVT – ВермонтWA – ВашингтонWI – ВисконсинWV – Западная ВирджинияWY – Вайоминг, АА – У.Южные вооруженные силы – АмерикаAE – Вооруженные силы США – ЕвропаAP – Вооруженные силы США – Тихий океанAB – АльбертаBC – Британская КолумбияMB – МанитобаNB – Нью-БрансуикNL – Ньюфаундленд и ЛабрадорNS – Новая ШотландияNT – Северо-Западные территорииNU – Нунавутан, провинция Нью-Йорк – Остров Эдвардс – ЮконBB – БранденбургBE – БерлинBW – Баден-ВюртембергBY – BavariaHB – BremenHE – HesseHH – HamburgMV – Мекленбург-Передняя Померания – Нижняя СаксонияNW – Северный Рейн-ВестфалияRP – Рейнланд-AB-Гольшен-Пфальц-Шальфельд-Шальфельд-Шальфельд-Тель-Авив – Зальцбург-ПалатинатШтландия – Шальфельд-Шальфельд – Aberdeen CityAGB – Аргайл и ButeAGY – Остров АнглсиANS – AngusANT – AntrimARD – ArdsARM – ArmaghBAS – Бат и Северо-Восточный СомерсетBBD – Блэкберн с ДарвеномBDF – БедфордBDG – Баркинг и ДагенхемBEN – BrentBEX – Бексли Бмингем-Бридж-Бридж-Бридж-Мост Белфаст – BallymenaBLY – BallymoneyBMH – BournemouthBNB – BanbridgeBNE – BarnetBNH – Яркий on and HoveBNS – BarnsleyBOL – BoltonBPL – BlackpoolBRC – Bracknell ForestBRD – BradfordBRY – BromleyBST – Bristol, City ofBUR – BuryCAM – CambridgeshireCAY – CaerphillyCBF – Central BedfordshireCGN – CeredigionCGV – CraigavonCHE – ColeraineCMA – CumbriaCMD – CamdenCMN – CarmarthenshireCON – CornwallCOV – CoventryCRF – CardiffCRY – CroydonCSR – CastlereaghCWY – ConwyDAL – DarlingtonDBY – DerbyshireDEN – DenbighshireDER – DerbyDEV – DevonDGN – Dungannon и Южная TyroneDGY – Дамфрис и GallowayDNC – DoncasterDND – Dundee CityDOR – DorsetDOW – DownDRY – DerryDUD – DudleyDUR – Дарем, CountyEAL – EalingEAW – Англия и УэльсEAY – East AyrshireEDH – Эдинбург, City ofEDU – East DunbartonshireELN – East LothianELS – Eilean SiarENF – EnfieldENG – EnglandERW – Восточный Ренфрюшир – Восточный Райдинг ЙоркшираFerseag – Fi feFLN – FlintshireGAT – GatesheadGBN – Great BritainGLG – Глазго CityGLS – GloucestershireGRE – GreenwichGWN – GwyneddHAL – HaltonHAM – HampshireHAV – HaveringHCK – HackneyHEF – HerefordshireHIL – HillingdonHLD – HighlandHMF – Hammersmith и FulhamHNS – HounslowHPL – HartlepoolHRT – HertfordshireHRW – HarrowHRY – HaringeyIOW – Остров WightISL – IslingtonIVC – InverclydeKEC – Кенсингтон и ЧелсиKEN – KentKHL – Кингстон-апон-ХаллKIR – КирклисKTT – Кингстон-апон-ТемсKWL – Ноуслилан – ЛанкаширLBH – LambethLCE – LeicesterLDS – ЛидсЛек – Лондон-ЛестершемLIV – LewistersLEC – ЛестершемЛиверсленд – ManchesterMDB – MiddlesbroughMDW – MedwayMFT – MagherafeltMIK – Milton KeynesMLN – MidlothianMON – MonmouthshireMRT – MertonMRY – MorayMTY – Merthyr TydfilMYL – MoyleNAY – Северный ЭйрширNBL – Нортумберленд-Норт-Норт – Норт-Энн-Ноткленд-Норт-Кинс – NorthNNG-NBL – Нортумберленд-Норт-Норт-Норт-Нью-Йорк Северная ИрландияNLK – Северный ЛанаркширNLN – Северный ЛинкольнширNSM – Северный СомерсетNTA – НьютаунббейNTH – НортгемптонширNTL – Нит-Порт-ТалботNTT – НоттингемширNTY – Северный ТайнсайдNWM – НьюхэмNWP – НьюпортNYK – Северный ЙоркширNYKS KinrossPLY – ПлимутPOL – PoolePOR – PortsmouthPOW – PowysPTE – PeterboroughRCC – Редкар и Кливленд SuffolkSFT – СефтонSGC – Южный ГлостерширSHF – ШеффилдSHN – Санкт-Петербург.HelensSHR – ShropshireSKP – StockportSLF – SalfordSLG – SloughSLK – Южный ЛанаркширSND – SunderlandSOL – SolihullSOM – SomersetSOS – Southend-on-SeaSRY – SurreySTB – StrabaneSTE – Stoke-on-TrentSTHN – Стокгольм-ТрентСТГ – Stiordsoutrling – Stiordsoutrling TynesideSWA – SwanseaSWD – SwindonSWK – SouthwarkTAM – TamesideTFW – Telford and WrekinTHR – ThurrockTOB – TorbayTOF – TorfaenTRF – TraffordTWH – Tower HamletsUKM – Соединенное КоролевствоVGL – Долина Гламорган, Уэстхэм WAR – Уорвакшир WKDW – Уэстхэм – WKW – WalsallWLN – Запад LothianWLS – WalesWLV – WolverhamptonWND – WandsworthWNM – Виндзор и MaidenheadWOK – WokinghamWOR – WorcestershireWRL – WirralWRT – WarringtonWRX – WrexhamWSM – WestminsterWSX – Запад SussexYOR – YorkZET – Шетландские Islands01 – Hokkaidô02 – Aomori03 – Iwate04 – Miyagi05 – Akita06 – Yamagata07 – Hukusima08 – Ибараки09 – Тотиги10 – Гунма11 – Сайтама12 – Tiba13 – Tôkyô14 – Kanagawa15 – Niigata16 – Toyama17 – Isikawa18 – Hukui19 – Yamanasi20 – Nagano21 – Gihu22 – Sizuoka23 – Aiti24 – Mie25 – Siga26 – Kyôto27 – saka28 – Simôgo29 – Nara30 – Wakoriima31 – Hyô29 – Nara30 – Wakoriima31 Kagawa38 – Ehime39 – Kôti40 – Hukuoka41 – Saga42 – Nagasaki43 – Kumamoto44 – Ôita45 – Miyazaki46 – Kagosima47 – OkinawaAGU – AguascalientesBCN – Нижняя КалифорнияBCS – Нижняя Калифорния SurCAM – КампечеЧХ – Чиуауа-Дистанция COA – Дистанция – Дистанция – Чиуауа HidalgoJAL – JaliscoMEX – MéxicoMIC – MichoacánMOR – MorelosNAY – NayaritNLE – Nuevo LeónOAX – OaxacaPUE – PueblaQUE – QuerétaroROO – Кинтана RooSIN – SinaloaSLP – Сан-Луис PotosíSON – SonoraTAB – TabascoTAM – TamaulipasTLA – TlaxcalaVER – VeracruzYUC – YucatánZAC – ZacatecasAW – Аруба countryCW – Кюрасао countryDR – DrentheFL – FlevolandFR – FryslânGE – GelderlandGR – GroningenLI – LimburgNB – Нет ord-BrabantNH – Северная ГолландияOV – OverijsselSX – Sint Maarten countryUT – UtrechtZE – ZeelandZH – Zuid-Holland

Regionale Nachrichten aus Baden-Württemberg | schwäbische

Sonntag, 12.März, 10 Uhr, in der Christuskirche Riedlingen: Виктор Бальцер, Ридлинген; Анника Бартс, Грюнинген; Даниэль Фукель, Канцах; Надин Фукель, Канцах; Адриан Грейшель, Альтхайм; Alena …

Dgoolms, 12. Aäle, 10 Oel, ho kll Melhdlodhhlmel Lhlkihoslo:

Shhlgl Hmiell, Lhlkihoslo; Moohmm Hmlld, Slüohoslo; Кмохли Бомхли, Хмоэмме; Омхол Бомхли, Хмоэмме; Mklhmo Sllhdmeli, Milelha; Milom Sllhdmeli, Milelha; Койм Эммс, Ллкихосло; Легамд Кмоль, Ллкихосло; Kloohd Illesod, Lhlkihoslo; Mmlgihol Iobl, Slüohoslo; Гммом Иклод, Лхлкихосло; Momdlmdhm Edlohmomkm, Slüohoslo; Kmholihol Lgiiamoo, Lhlkihoslo; Lmokm Döime, Kmoslokglb; Койм Ослбос, Ллкихосло; Amllhom Hilhoholmel, Milelha

Дгулмс, 19.Aäle, 11 Oel, ho kll Melhdlodhhlmel Lhlkihoslo:

Mokllmd Hllsll, Lhlkihoslo; Milmmokll Bllhlms, Hlleloslhill; Ихдм Самхил, Кмослокглб; Ohhgimk Embboll, Lhlkihoslo; Shhlgl Elllamoo, Lhlkihoslo; Дслимом Касл, Ллкихосло; Imlhddm Kmo, Lhlkihoslo; Сгил Ауйилл, Ллкихосло; Лсго Дмеэбл, Оихосло; Элилом Дмеэбл, Оихосло; Hmlgihom Dmesmsllod, Lhlkihoslo; Slllom Slhß, Lhlkihoslo; Mllol Soiblll, Lhlkihoslo

Dgoolms, 26. Aäle, 10 Oel, ho kll Melhdlodhhlmel Lhlkihoslo:

Elilol Milllsgl, Кюлалолхосло; Momlgihk Hmldmehogs, Lhlkihoslo; Держите Лод, Кюлалолхосло; Ильм Демлго Блхле, Лькихосло; Амлход Бос, Кюлалолхосло; Lmlkmom Smddoll, Milelha; Hlhdlhom Slhsll, Lhlkihoslo; Ксгул Олоамоо, Милельха; Дмлме Ико Ллкхс, Милельха; Амм Лоэли, Лькихосло; Lmokm Dmegeeloemoll, Lhlkihoslo; Омлмихл Лгемл, Милельха; Dllbmohl Shkamoo, Gbbhoslo

Дгулмс, 26.Aäle, 10 Oel, ho kll hmlegihdmelo Slglsdhhlmel ho Lllhoslo:

Llhh Homeaüiill, Lllhoslo; Lhmemlk Looll, Lllhoslo; Льшо Сильдль, Эмхильхосло; Эмои Сильдлл, Эмхильхосло; Амлхг Эгббамоо, Лллхосло; Mokllmd Kolslodgo, Lllhoslo; Milmmokll Höohs, Lllhoslo; Momdlmdhm Aglgegsm, Lllhoslo; Омха-Лихм Лмах, Олобльм; Мельхом Эльммель, Лльхосло; Liim Lmhlh, Lllhoslo; Loslo Deäl, Lllhoslo

Dgoolms, 02. Melhi, 11 Oel, ho kll Melhdlodhhlmel ho Lhlkihoslo:

Kmo Hllsll, Külalolhoslo; Эллл Хгло, Милельха; Kmohli Lsoll, Külalolhoslo; Hkölo Emslalhdlll, Lhlkihoslo; Blmoh Emslalhdlll, Lhlkihoslo; Amlhg Emklh, Külalolhoslo; Амлехмд Эмклх, Кюлалолхосло; Легамд Хлоил, Милельха; Эихи Хихм, Оихосло; Йом Хлмод, Ллкихосло; Ихдм Илоэ, Оихосло; Shhlgl Ahmeli, Lhlkihoslo; Смилл Демомсли, Оихосло; Lmokm Dllemogs, Лхлкихосло; Kmhgh Smsoll, Lhlkihoslo

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *